Strain Information
Name | VC3994 View On Wormbase Documentation for VC3994 gk5066 F25H2.3 |
---|---|
Species | C. elegans |
Genotype | F25H2.3(gk5066[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. |
Description | Homozygous viable. Deletion of 1526 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCACAATTACGATCAGGTTTTATGTATG; Right flanking sequence: TATTTTTAGAGATCTTCAAACGAAGATCAG. See WormBase Variation gk5066 for details. |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | Vancouver KO Group |
Laboratory | DM |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.