Strain Information

Name VC3807   View On Wormbase Documentation for VC3807 gkDf64 srg-3 to srg-8
Species C. elegans
GenotypegkDf64[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] III.
DescriptionHomozygous viable. Deletion of 17117 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGTCCTCAACTTTTCATTCTGTTGTA; Right flanking sequence: AGGAAATTGTCCCACAAGTTTGAAATGGTA. See WormBase Rearrangement gkDf64 for details.
MutagenCrispr/Cas9
Outcrossedx0
Made byVancouver KO Group
Laboratory DM
Reference n/a
Sign in or register an account if you want to order this strain.