Search Strains

mScarlet-I::AID*::3xFlag tags inserted at the C-terminus of the endogenous ifet-1 locus. wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. ifet-1 visualized by mScarlet in oocytes with inducible acute degradation when grown on 4mM auxin. No defect in hermaphrodite embryo viability. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

louIs7 [ges-1p::sqst-1::mCherry::GFP::unc-54 3'UTR]. Tandemly-tagged p62/sequestosome marker expressed in the gut can be used to monitor autophagic activity. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

louIs8 [ges-1p::nuc-1::mCherry::unc-54 3'UTR]. mCherry-tagged lysosomal nuclease NUC-1 expression can be used to monitor lysosomes in the gut. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

louIs10 [myo-3p::sqst-1::mCherry::GFP::unc-54 3'UTR]. Tandemly-tagged p62/sequestosome marker expressed in the muscle can be used to monitor autophagic activity. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

louIs2 [ges-1p::mCherry::GFP::SKL::unc-54 3' UTR]. Expresses a mCherry::GFP::serine-lysine-leucine peroxisome signal sequence (SKL) fluorescent pexophagy reporter in the C. elegans intestine. Generated in N2 background. Reference: Dolese DA, et al. Autophagy. 2022 Jul;18(7):1522-1533. https://doi.org/10.1080/15548627.2021.1990647 PMID: 34689720

seaIs201 [myo-3p::human tau (0N4R;V337M)::unc-54 3'UTR + vha-6p::mCherry::unc-54 3'UTR]. Reduced crawling speed, reduced brood size, shortened lifespan, slow development, early paralysis. Human tau transgene is expressed in body wall muscles, producing strong phenotypes suitable for screening and is sensitive to knockdown by feeding RNAi. Generated in N2 background.

Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.

kasEx80 [oig-1p::tagRFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to maintain array. RFP driven by minimal oig-1 promoter for expression in VD-type GABAergic motor neurons. This construct uses the minimal length of promoter containing overlapping LIN-39 and UNC-30 ChIp-seq peaks (deletion of the single LIN-39 binding site within it compromised GABAergic motor neuron expression). Whereas other available oig-1 constructs are expressed ectopically in cholinergic motor neurons in unc-3 mutants, expression of this construct remains exclusively in GABAergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasIs9 [snb-1p::(delta)C9 ubi + myo-2::GFP]. The transgene has the snb-1 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: https://pubmed.ncbi.nlm.nih.gov/34654821/

kasEx147 [oig-1p(1.6kb)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 1.6kb cis-regulatory region (-2.6-1.0kb) upstream of oig-1 was fused to GFP with the unc-54 3'UTR. oig-1 uses mulitple cis-regulatory regions to achieve different expression patterns in motor neurons; this construct drives expression specifically in cholinergic motor neurons. Construct was injected into N2 worms. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx149 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 200bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is been abolished; expression was observed specifically in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain allows somatic depletion of NHR-25::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY84 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain for somatic depletion of NHR-23::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY87 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.

ckSi17 [cdk-12::GFP::mex-5 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi20 [cdk-9::mCherry::mex-5 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi21 [cdk-9::GFP::pal-1 3'UTR + unc-119(+)] II. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi21 [cdk-9::mCherry::pal-1 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi21 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).

ckSi25 [cit-1.2::FLAG::ccnk-1 3'UTR + unc-119(+)] II. GFP is expressed in all somatic nuclei. Reference: Bowman EA, et al. Development. (In Press).

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. lqIs58 [gcy-32::CFP] V. Reference: Josephson MP, et al. PLoS One. 2016 Feb 10;11(2):e0148658.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. lqIs80 [SCMp::GFP::caax] IV. Rollers. GFP expression in seam cells. Red fluorescence in vulvae. YFP cannot be detected.

Deletion in promoter region and 5' UTR.

cp21[hmr-1::GFP + LoxP] I. GFP inserted at the C terminus of endogenous hmr-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

cpIs56 [mex-5p::TagRFP-T::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cp65[mrck-1::YPet + LoxP]. YPet inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. Yellow fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

cpIs53 [mex-5p::GFP-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cpIs54 [mex-5p::mKate::PLC(delta)-PH(A735T)::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cpIs55 [mex-5p::mCherry-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cpIs64 [mex-5p::mYPet::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cp189[mrck-1::GFP::3xFlag]. GFP inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

cpIs89 [wrt-2p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs85 [egl-20p::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. 2x mTurquoise2::PH membrane marker expressed in seam cells, Q neuroblasts, and many hypodermal cells. Expression of 2x mKate2::PH membrane marker driven by egl-20 upstream intergenic sequence. cpIs89 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs85 is a single copy transgene inserted at Chr II:8420157-8420243 near ttTi5605 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

cpIs158 [myo-3p::pat-3sp::2x vhhGFP4::CD8 tm::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs130 [wrt-2p::2x mKate2::PH::3xHA::let-858 3'UTR::tag-168p::HisCl1::tbb-2 3'UTR loxN] II. YPET::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. cpIs158 expresses a membrane-anchored anti-GFP nanobody (Morphotrap) in body wall muscles. This version of Morphotrap consists of extracellular 2x vhhGFP4 fused to a human CD8 transmembrane domain and intracellular 2x mTurquoise2. Endogenously tagged EGL-20::YPET::3xFlag is efficiently sequestered by the Morphotrap transgene (the transgene functions as expected for Wnt), leading to Q neuroblast migration defects. NOTE: cpIs158/Morphotrap does not capture all YPET-tagged extracellular proteins, so sequestration should be determined empirically. cpIs130 is a single copy transgene expressing a 2x mKate2::PH membrane marker in seam cells, Q neuroblasts, and many hypodermal cells, and HisCl1 expression from the tag-168 upstream intergenic sequence. Expression of HisCl1 from the single copy insertion does not appear to be sufficient for immobilizing animals. cpIs158 was inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs130 was inserted at Chr II:8420157-8420243 near ttTi5605. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234

Maintain at 15C. Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234

cpSi171 [vha-8p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in multiple tissues including intestine, hypodermis, and excretory cell.

cpSi172 [myo-2p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in the pharynx.

cpSi174 [myo-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in body wall muscle.

lstEx3 [pdf-2p::pdf-2::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. pdf-2 over-expressing line with aberrant locomotion. Reference: Janssen T, et al. J Biol Chem. 2008 May 30;283(22):15241-9.

lstEx24 [pdf-2p::pdf-2::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. lst24 rescues pdf-2; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

lstEx25 [pdfr-1p::pdfr-1::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. lst25 rescues pdfr-1; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

lstEx112 [unc-119p::pdfr-1a::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1a isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

lstEx117 [unc-119p::pdfr-1b::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1b isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

lstEx122 [unc-119p::pdfr-1c::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1c isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

lstEx2 [pdf-1p::pdf-1::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. pdf-1 over-expressing line with wild-type locomotion. Reference: Janssen T, et al. J Biol Chem. 2008 May 30;283(22):15241-9.

lstIs1 [pdf-1p::pdf-1::3'UTR + elt-2p::GFP]. pdf-1 over-expressing line with wild-type locomotion. Reference: Janssen T, et al. J Biol Chem. 2008 May 30;283(22):15241-9.

xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]