Search Strains

More Fields
Strain Species Genotype Add
OH15579 C. elegans che-1(ot908 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
OH15683 C. elegans che-1(ot871 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
OH1571 C. elegans tax-2(ot25) otIs114 I; him-5(e1490) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic lim-6 expression in a set of cells anterior to ASE. Molecular identity: W40Stop. Null allele.
OH158 C. elegans zig-4(gk34) X. Show Description
C09C7.1 Deletion breakpoints at position 237 and 803 with insertion of CTTGTATAGCAAGAAACC at this breakpoint. Predicted molecular null. About 30% penetrance of displaced axons in the ventral nerve cord. Homozygous viable.
OH16376 C. elegans ceh-44(ot1028) III. Show Description
ot1028 = 80bp deletion on Exon 8 (first exon isoform A - isoform with CUT domains), leading to a frameshift and early stop codon in Exon 8 expected to affect only isoform A. Deletion coordinates: +9069 to +9148. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. ot1028 is molecularly identical to ot1031.
OH16636 C elegans pha-1(e2123) III; otIs669 him-5(e1490) V; otEx7603. Show Description
otEx7603 [nlp-52p::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. The nlp-52 reporter construct contains the full intergenic region of nlp-52 as the promoter. GFP expression in a subset of cells of the nervous system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
OH17489 C. elegans egIs1 IV; otIs860. Show Description
egIs1 [dat-1p::GFP]; reportedly maps to LG IV. otIs860 [flp-33p::tagRFP]. CEP neurons are marked with bright green expression (dat-1p::GFP), and can be sorted by selecting the brightest GFP. there are other cells in which the GFP marker shows up, but expression is faint. Other fluorescing neurons (ADE and PDE) will be double positive (GFP and tagRFP). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
OH17918 C. elegans lep-5(ot1215[lep-5p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails.
OH17921 C. elegans linc-3(ot1217[linc-3p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) V. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-3 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
OH17923 C. elegans linc-19(ot1219[linc-19p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) III. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-19 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
OH17929 C. elegans linc-23(ot1225[linc-23p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.
OH17932 C. elegans linc-26(ot1227[linc-26p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad and extremely dim expression in hermaphrodite spermatheca.
OH17935 C. elegans linc-36(ot1229[linc-36p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-36 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the sperm of both hermaphrodites and males.
OH17938 C. elegans linc-41(ot1231[linc-41p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-41 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad, spermatheca of hermaphrodites, as well as several other tissues in the head.
OH17942 C. elegans tts-1(ot1234[tts-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the tts-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in several tissues including the pharynx but is significantly upregulated in a stress-dependent manner in a variety of tissues.
OH18019 C. elegans linc-1(ot1249[linc-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.
OH18353 C. elegans pha-1(e2123) III; otEx8029. Show Description
otEx8029 [ceh-19(prom 2)::GFP + pha-1(+)]. Maintain 25C to select for array. Modified ceh-19 promoter fragment drives bright expression of GFP in MC L/R. There is also expression in an additional unidentified cell in the tail but this expression is much much dimmer and typically not visible under the dissecting scope. GFP expression in MC can be used to isolate MC by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
OH18424 C. elegans pha-1(e2123) III; otEx8047. Show Description
otEx8047 [pks-1p::TagRFP + pha-1(+)]. Maintain at 25C to select for array. TagRFP expression marks CAN neurons.
OH898 C. elegans pha-1(e2123) III; otEx536. Show Description
otEx536 [ser-2(prom2)::GFP + pha-1(+)]. Maintain at 25C to select for transgenic animals.
OP50/cytR- Escherichia coli E. coli [cytR-] Show Description
Bacteria. Kanamycin-resistant E. coli. cytR- mutation in OP50 background causes elavated nucleotide levels similar to HT115. A mutation in CytR- was introduced into the OP50 strain by recombineering. Bacterial cells were transformed with pSIM8 plasmid before using as hosts for recombineering. Targeting substrate DNA fragments were amplified by PCR and subcloned into TOPO cloning vector for sequence verification before being electroporated into the host bacterial cells. The primer set used for cloning targeting cytR substrate DNAs (to replace cytR+ with the cytR- mutation identified in HT115 strain): 5'- GCCAGGCGAGGAGTGAGTGTG-3'/5'-AGCGGCGGGCCTTTGACC-3'. Reference: Chi C, et al. Genes Dev. 2016 Feb 1;30(3):307-20.
OW1601 C. elegans dvIs62 X. Show Description
dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16C to minimize selection against transgene. [NOTE: Out-crossing has eliminated embryonic lethality seen in parental strain CL6049 when raised at 25C.] Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Parental strain CL6049 out-crossed 6x to N2. Reference: Koopman M, et al. MicroPubl Biol. 2023 Apr 19:2023:10.17912/micropub.biology.000766. doi: 10.17912/micropub.biology.000766. eCollection 2023. PMID: 37151213.
OW1603 C. elegans dvIs15. Show Description
dvIs15 [unc-54(vector) + mtl-2::GFP]. Control strain for OW1601. Phenotype apparently Wild-type. Parental strain CL2122 out-crossed 6x to N2. Reference: Koopman M, et al. MicroPubl Biol. 2023 Apr 19:2023:10.17912/micropub.biology.000766. doi: 10.17912/micropub.biology.000766. eCollection 2023. PMID: 37151213.
PB206 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.
PB212 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.
PB219 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Cox Arboretum, Dayton Ohio. Species ID confirmed by mating test with EM464.
PB227 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Taylorsville MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
PB228 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Armadillidium vulgare, that was collected from Eastwood MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
PB229 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Cylisticus convexus, that was collected from Englewood MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
PD2882 C. elegans unc-54(cc2882[unc-54[G387R]::gfp::TAA::NSUTR]) I. Show Description
cc2882 is a CRISPR/Cas9-induced G387R mutation of unc-54 in parental strain PD2859, mimicking the molecular lesion e1301. Unc at room temperature. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.
PD7271 C. elegans pha-1(e2123) III; ccEx7271. Show Description
ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Sporadic germ cell expression can be observed when maintained at 25C.
PG-1 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PG-2 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PG-3 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PHX2457 C. elegans dmsr-7(syb2457) V. Show Description
Molecular null allele. syb2457 is a CRISPR-engineered deletion of the entire dmsr-7 coding region. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX5866 C. elegans flp-11(syb5866) X. Show Description
Molecular null allele. syb5866 is a CRISPR-engineered deletion of the entire flp-11 coding region. Strongly reduces sleep. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX6333 C. elegans dmsr-1(syb6331 syb6333[FRT::dmsr-1 exons 2-3::FRT]) V. Show Description
Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PS6038 C. elegans unc-119(ed3) III; syEx1136. Show Description
syEx1136 [myo-2p::GFP + unc-119(+)]. unc-119 animal rescued with array that expresses GFP in the pharyngeal muscles. Pick non-Unc animals to maintain the array. Highly outcrossed version of unc-119(ed3) generated by the Sternberg lab. Pick Unc animals for heavily outcrossed unc-119(ed3) to use for out-crossing biolistic insertions, mosSCI insertions or miniMos insertions based on unc-119 selection. Reference: Frokjær-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8.
PS6058 C. elegans pha-1(e2123) III; him-5(e1490) V; syEx1147. Show Description
syEx1147 [des-2::DES-2::GFP + pha-1(+) + pBluescript KS(+)]. Maintain at 25C to select for presence of transgene. GFP reporter is driven by the promoter of the des-2/des-3 operon and is expressed in ALA, RID, PVD, FLP, IL2, PLM, PVC, and M1 muscles of the pharynx. This construct contains 3.4 kb of sequence upstream of the des-2 start ATG (Treinin et al., 1998) (Van Buskirk and Sternberg, 2010).
PX439 C. remanei Caenorhabditis remanei wild isolate. Show Description
Male-female strain. Low fecundity and fitness. PX439 is an inbred derivative of isofemale line PB259 originally collected from a forest in Ohio (USA) by Scott Baird (Wright State University). Reference: Fierst JL, et al. PLoS Genet. 2015 Jun 26;11(6):e1005323. doi: 10.1371/journal.pgen.1005323. PMID: 26114425.
PX534 C. latens Caenorhabditis latens wild isolate. Show Description
Inbred strain with low fecundity and fitness. Originally collected in Wuhan, China. Reference: Adams PE, et al. Mol Biol Evol. 2023 Mar 4;40(3):msad039. doi: 10.1093/molbev/msad039. PMID: 36807460.
PX624 C. elegans fxSi1 I; spe-44(fx123[spe-44::AID*]) IV; fog-2(fx111) V. Show Description
fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
PX631 C. elegans fxSi3 I; fxSi4 II; fog-2(q71) V. Show Description
fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
PX658 C. elegans fxSi1 I; fxSi4 II; fxSi6 III; spe-44(fx123[spe-44::AID*]) IV; fog-2(fx111) V. Show Description
fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
PX696 C. elegans fxIs10 II. Show Description
fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924
PX725 C elegans fxSi8 I. Show Description
fxSi8 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi8 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi8 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX726 C elegans fxSi9 I. Show Description
fxSi9 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi9 is a CRISPR-engineered site in the MY16 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi9 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX727 C elegans fxSi10 I. Show Description
fxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX728 C elegans fxSi11 I. Show Description
fxSi11 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi11 is a CRISPR-engineered site in the JU775 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi11 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX736 C elegans fxSi13 III. Show Description
fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).
QG1 C. elegans qgIR1 (X, CB4856>N2) X. Show Description
qgIR1 (X, CB4856>N2, haw102573 to 4,822,488) X. The strain is a nearly isogenic line that carries the CB4856 version of npr-1 in an otherwise N2 genetic background. NIL derived from RIAIL QX58 linked then unlinked to mec-2 from CB3273 lon-2 mec-2, then backcrossed to lon-2 for 12 generations selecting nonLon worms, then homozygosed. Genotyped N2 at pkP6106 and pkP6145. Based on QG613 sequencing, interval is from X:4,754,307-4,864,273.