Search Strains

Broad puncate expression in non-neuronal cells, later expression initiatiated ~1.5-2 fold stage. wrmScarlet tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

CRISPR/Cas9-engineered mutation of residues that mediate interaction with TOL-1 receptor in development. Reduced brood size, high levels of embryonic and larval arrest. syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

syIs589 [15xUAS::wrmScarlet::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] mScarlet cGAL effector.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.

Endogenous mlc-2 locus co-expresses LifeAct peptide fused to wrmScarlet. Myosin light chain is untagged. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Broad bands of fluorescence are visible in body wall muscle by confocal microscopy. Please contact Ryan Littlefield prior to publishing work with this strain.

Dumpy roller. Endogenous mlc-2 locus co-expresses LifeAct peptide fused to wrmScarlet. Myosin light chain is untagged. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Broad bands of fluorescence are visible in body wall muscle by confocal microscopy. Please contact Ryan Littlefield prior to publishing work with this strain.

4xwrmScarlet11 tag inserted inserted at 5' end of rab-3b locus using CRISPR/Cas9. Insertion confirmed by sequencing. wrmScarlet11::RAB-3B shows smaller RAB-3 puncta compared to over-expression reporters. The fusion protein is likely non-functional as the strain shows strong aldicarb resistance; however, the localization pattern of 4×wrmScarlet::RAB-3 is similar to that of transgenically expressed RAB-3. 4×wrmScarlet11::rab-3b strain also labels rab-3a; it is possible that 4×wrmScarlet11 inserted in the middle of rab-3a isoform disrupts the functions of RAB-3 in neurotransmission. Reference: Kurashina M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.

wbmIs63 [myo-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs61] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs63 exhibits muscle-specific wrmScarlet expression driven the myo-3 promoter. Derived from parental strain WBM1126 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome (wbmIs61). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs67 [eft-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs65] (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs67 exhibits soma-specific wrmScarlet expression driven the eft-3 promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs68 [rab-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs66] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs68 exhibits neuron-specific wrmScarlet expression driven the rab-3 promoter. Derived from parental strain WBM1141 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific rab-3 promoter inserted as a single copy into the C. elegans genome (wbmIs66). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs79 [eft-3p::3XFLAG::raga-1::SL2::wrmScarlet::unc-54 3'UTR] *wbmIs67. Somatic-specific RAGA-1 and wrmScarlet expression driven by the eft-3p promoter. Derived by CRISPR-mediated insertion of raga-1 downstream of tissue-specific eft-3 promoter of wbmIs67 insertion in parental strain WBM1143. wbmIs67 [eft-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs65] (V:8645000). Reference: Zhang Y, et al. Elife. 2019 Aug 14;8:e49158. doi: 10.7554/eLife.49158. PMID: 31411562.

wbmIs80 [rab-3p::3XFLAG::raga-1::SL2::wrmScarlet::rab-3 3'UTR] *wbmIs68. Neuron-specific RAGA-1 and wrmScarlet expression driven by the rab-3 promoter. Derived by CRISPR-mediated insertion of raga-1 downstream of tissue-specific eft-3 promoter of wbmIs68 insertion in parental strain WBM1144. wbmIs68 [rab-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs66] (IV:5015000). Reference: Zhang Y, et al. Elife. 2019 Aug 14;8:e49158. doi: 10.7554/eLife.49158. PMID: 31411562.

wbmIs88 [eft-3p::3XFLAG::dpy-10::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs67]. (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of the soma-specific eft-3 promoter. wbmIs88 exhibits soma-specific dpy-10 and wrmScarlet expression driven the eft-3 promoter. Derived from parental strain WBM1143 by CRISPR-mediated modification of tissue-specific transgene. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs89 [rab-3p::3xFLAG::dpy-10::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs68] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of the neuron-specific rab-3 promoter. wbmIs68 exhibits neuron-specific dpy-10 and wrmScarlet expression driven the rab-3 promoter. Derived from parental strain WBM1144 by CRISPR-mediated modification of tissue-specific transgene. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs118 [myo-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs114] I. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in muscle. wrmScarlet expression in muscle. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs114. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs99 [rab-3p::3xFLAG::rpl-22::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs89] IV. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs89. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs119 [eft-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs88] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in soma. wrmScarlet expression in soma. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs88. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wrmScarlet tag inserted at the C-terminus of the endogenous scpl-4 locus using CRISPR/Cas9. C.elegans ortholog of human TIMM50 translocase of inner mitochondrial membrane 50. SCPL-4::wrmScarlet expression in inner mitochondrial membrane. Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.

GFP tag inserted at the C-terminus of the endogenous tomm-70 locus using CRISPR/Cas9. wrmScarlet tag inserted at the C-terminus of the endogenous scpl-4 locus using CRISPR/Cas9. TOMM-70::GFP expressed in mitochondrial outer membrane. SCPL-4::wrmScarlet expression in inner mitochondrial membrane. Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249

muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.

Endogenous dmd-4 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Stefanakis N, et al. Development. 2025 Jul 15;152(14):dev204622. doi: 10.1242/dev.204622. PMID: 40728647.

rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.

Severing and tagging of endogenous locus with trans-splicing ICR and GFP using CRISPR/Cas9. Pharynx and body muscles are green fluorescent and visible by dissection fluorescence microscopy. Severing is located upstream of kinase domain. Please contact Ryan Littlefield prior to publishing work using this strain.

Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Pharynx and body muscles are green and red fluorescent and visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work using this strain.

Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Pharynx and body muscles are green; red fluorescence only in body wall muscles. Please contact Ryan Littlefield prior to publishing work using this strain.

8xmScarlet11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.

8xwrmScarlet11 tag inserted at 5' end of endogenous syd-2 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.