Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1302 C. elegans Y2C2A.1(ok1409) IV. Show Description
Y2C2A.1 Homozygous. Outer Left Sequence: tcccatcattctccgaaaag. Outer Right Sequence: gaagaggtggtcgatcagga. Inner Left Sequence: ttgaatgcgtatcggatgaa. Inner Right Sequence: agctcgaggggttttctctc. Inner Primer PCR Length: 3007. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1777 C. elegans F45E4.3(ok2285) IV. Show Description
F45E4.3. Homozygous. Outer Left Sequence: AAAAGTTGCGCTTCCAAAAA. Outer Right Sequence: TCAAAACGAATCAACGACCA. Inner Left Sequence: CGCTTTTGTAGAAAAACACGG. Inner Right Sequence: TGCATCGGCATTTGTTGTAT. Inner Primer PCR Length: 3120 bp. Deletion Size: 2410 bp. Deletion left flank: TTTGAGATATCAAACGATCGGAAACTAGTA. Deletion right flank: CCGACAGTATGGAGCCGCACCACCTCCAAC. Insertion Sequence: ATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB778 C. elegans F32E10.7(ok560) IV. Show Description
F32E10.7. Homozygous. Outer Left Sequence: CAGGAAACGTCTGTTCAGCA. Outer Right Sequence: CTCGTCTACAGTCGGAAGCC. Inner Left Sequence: TCTGCTCTTCCTCCAACACC. Inner Right Sequence: GTGGTCGATCAGGAATCGTT. Inner primer WT PCR product: 2879. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC387 C. elegans cla-1(ok618) IV. Show Description
Y2C2A.1/tag-80. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC596 C. elegans cla-1(gk352) IV. Show Description
F45E4.4/tag-80. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC631 C. elegans cla-1(ok937) IV. Show Description
F45E4.4/tag-80. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC737 C. elegans cla-1(gk319) IV. Show Description
F45E4.4/tag-80. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
OH15881 C. elegans otEx7363. Show Description
otEx7363 [flp-3p::mCherry + flp-3p::GFP::cla-1 + unc-122p::GFP]. Pick GFP+ animals to maintain. Presynaptic GFP::cla-1 reporter for IL1 neurons with cytoplasmic IL1p::mCherry in the background. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479.
OH16391 C. elegans otEx7501. Show Description
otEx7501 [pdfr-1::GFP::cla-1 + pdfr-1::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Presynaptic GFP::cla-1 reporter for pharyngeal I1 neurons. Reference: Cook SJ, et al. J Comp Neural. 2020 Nov 1;528(16):2767-2784. doi: 10.1002/cne.24932. PMID: 32352566.
OH16395 C. elegans otEx7505. Show Description
otEx7505 [ceh-19p::GFP::cla-1 + ceh-19p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Presynaptic GFP::cla-1 reporter for pharyngeal MC neurons. Reference: Cook SJ, et al. J Comp Neural. 2020 Nov 1;528(16):2767-2784. doi: 10.1002/cne.24932. PMID: 32352566.
OH16700 C. elegans otIs785. Show Description
otIs785 [ceh-34p::GFP::CLA-1 + ceh-34p::TagRFP + rol-6(su1006)]. Rollers. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH16737 C. elegans otIs788. Show Description
otIs788 [cat-4p::GFP::cla-1 + cat-4p::mCherry + inx-16p::tagRFP]. GFP-tagged CLA-1 provides a synaptic marker in HSN neurons. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH16866 C. elegans otIs810. Show Description
otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH16971 C. elegans otIs816. Show Description
otIs816 [klp-6p::mCherry + klp-6p::GFP::cla-1]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH18145 C. elegans otIs883. Show Description
otIs883 [srab-20p::GFP::cla-1 + unc-122p::mCherry]. Presynaptic GFP::cla-1 reporter for PHB neurons. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479.
OH18559 C. elegans him-5(e1490) V; otIs810. Show Description
otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1].
TV24786 C. elegans wyIs891 III; cla-1(wy1233[cla-1::FLPon::mScarlet-I]) IV; syd-2(wy1052[GFP::syd-2]) X. Show Description
wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous cla-1 locus. GFP tag inserted into endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
TV25898 C. elegans cla-1(wy1418[cla-1::GFP]) IV. Show Description
GFP tag inserted into endogenous cla-1 locus. Created from germline flipped-out cla-1(wy1218). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
UJ2587 C. elegans elks-1(miz365[elks-1::7xGFP11]) IV. Show Description
7xGFP11 tag inserted into endogenous elks-1 locus. ELKS-1::7xGFP localizes to tip of synapses similar to CLA-1. miz365 genotyping primers: F: TACCGGCTCCAGTGATTCC / R: tgtgtgccattggatgtgag (wt = 203bp, mutant = 676bp). Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ2820 C. elegans cla-1(miz321[cla-1::7xGFP11]) IV. Show Description
7xGFP11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ3233 C. elegans cla-1(miz378[cla-1::8xwrmScarlet11]) IV. Show Description
8xmScarlet11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.