Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RG3548 C. elegans +/nT1 [umnIs49] IV; scpl-4(ve1048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 2742 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1048 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TATTTCTCATTATACAAAAATTTCAGATTT; Right flanking sequence: CGGTATATGACAGTTGAATTCTCCGTCTAC. scpl-4 crRNA A: TAAATCTCTTCTGGGCCCAC; scpl-4 crRNA B: ACACTAGAGTTGTTCAGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
WBM1688 C. elegans scpl-4(wbm108[scpl-4::wrmScarlet]) V. Show Description
wrmScarlet tag inserted at the C-terminus of the endogenous scpl-4 locus using CRISPR/Cas9. C.elegans ortholog of human TIMM50 translocase of inner mitochondrial membrane 50. SCPL-4::wrmScarlet expression in inner mitochondrial membrane. Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.
WBM1689 C. elegans tomm-70(wbm81[tomm-70::GFP) III; scpl-4(wbm108[scpl-4::wrmScarlet]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous tomm-70 locus using CRISPR/Cas9. wrmScarlet tag inserted at the C-terminus of the endogenous scpl-4 locus using CRISPR/Cas9. TOMM-70::GFP expressed in mitochondrial outer membrane. SCPL-4::wrmScarlet expression in inner mitochondrial membrane. Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.