More Fields
Strain Species Genotype
CDH2 C. elegans pduEx2. Show Description
pdeEx2 [pCE-bJUN-VN173 + pCE-bFOSdeltaZIP-VC155 + rol-6(su1006)]. Pick Rollers to maintain. Heat-shock induces protein expression but NO BiFC complementation.
CF4616 C. elegans muIs252 II; unc-119(ed3) III; vha-13(muIs264[wrmScarlet11(x2)::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
DDP2 C. elegans uonEx2. Show Description
uonEx2 [unc-54::CFP::YFP(Venus)]. No additional transformation marker was included in the array. uonEx2 also known as CV in reference publications. Lifespan and pharyngeal pumping rates are similar to N2. This is a high-FRET positive control strain for use in conjunction with DDP1. Because the CFP and YFP protein sequences are covalently fused together (and show little evidence of cleavage), FRET should be high and largely invariant since both fluorescent moieties are always in close proximity. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.
DLM3 C. elegans ttTi5605 II; unc-119(ed3) III; uwaEx2. Show Description
uwaEx2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
EGD282 C. elegans egxSi100 II; unc-119(ed3) III; mex-5(egx2[T186A]) IV. Show Description
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1 forms a weaker gradient in the cytoplasm of the one-cell zygote than in wild-type. Reference: Han et al, Current Biology 2017.
EU573 C. elegans orEx2. Show Description
orEx2 [mlc-4p::mlc-4(genomic coding)::GFP::unc-54 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. Rollers are GFP+.
GLW2 C. elegans attf-2(utx2[mNG::attf-2]) V. Show Description
Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'
IB16 C. elegans ceh-17(np1) I. Show Description
WT behavioral phenotype. Axon guidance defect in ceh-17 expressing neurons ALA and 4SIA. ceh-17 = D1007.1, a C. elegans paired homeodomain transcription factor, Phox2 orthologue. np1 is a molecular null. np1 is a 1353 bp deletion inculding 549 bp upstream of the initiator ATG and extending to the 5th codon of the homeodomain.
JA1403 C. elegans unc-119(e2498) III; weIs15. Show Description
weIs15 [pie-1p::GFP::eea-1(FYVEx2) + unc-119(+)]. Phenotypically wild type. Early endosomes in germline and embryos are GFP+. GFP is fused to the tandem FYVE domains of eea-1/T10G3.5, under control of the pie-1 promoter. Grows at any temp, but has bright GFP at 25C.
JCP152 C. elegans dpy-11(e224) ccz-1(t2129) V; jcpEx2. Show Description
jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
JJ1142 C. elegans hmr-1(zu248) I; zuEx2. Show Description
zuEx2 [W02B9(cosmid) + rol-6(su1006). Maintain by picking Rollers.
LSC84 C. elegans lstEx2. Show Description
lstEx2 [pdf-1p::pdf-1::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. pdf-1 over-expressing line with wild-type locomotion. Reference: Janssen T, et al. J Biol Chem. 2008 May 30;283(22):15241-9.
OH4841 C. elegans otIs92. Show Description
otIs92 [flp-10::GFP]. Derived by integration of ynEx2.
PS4112 C. elegans plc-1(rx1) X; kfEx2. Show Description
kfEx2[plc-1(+) + sur-5::GFP]. plc-1(rx1) homozygotes are semi-Sterile. Animals with the array have normal brood size. To maintain, pick GFP+ worms. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
QC114 C. elegans etEx2. Show Description
etEx2 [glo-1p::GFP::ras-2 CAAX + rol-6(su1006)]. Rollers. Pick Rollers to maintain. etEx2 contains plasmid pQC09.6, which carries the ras-2 CAAX motif at the C-terminus of GFP; this array is a prenylation reporter. Reference: Mörck C, et al. Proc Natl Acad Sci U S A. 2009 Oct 27;106(43):18285-90.
RT17 C. elegans rab-10(dx2) I. Show Description
Temperature sensitive. Maintain at 15C.
SAL105 C. elegans pha-1(e2123) III; denEx2. Show Description
denEx2 [lys-7::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.
SP1750 C. elegans mec-8(u74) I; mnEx2. Show Description
mnEx2 [mec-8(+) + rol-6(su1006)]. Rollers. Pick rollers to maintain.
TG11 C. elegans cep-1(lg12501) I; unc-119(ed4) III; gtEx2. Show Description
gtEx2[CEP-1::GFP + unc-119(+)]. GFP expression in germ line of adult worms (20-40 hours post L4) in the late pacytene area in the nucleus. Also expression in alae and a few nuclei in the pharynx. Compound microscope needed to see staining. Maintain by picking non-Unc.
UA2 C. elegans baEx2. Show Description
baEx2 [lis-1::GFP + rol-6(su1006)]. Maintain by picking Rollers.
UTK3 C. elegans cam-1(ak37) II; mbr-1(qa5901) X; utkEx2. Show Description
utkEx2 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
AGD397 C. elegans aak-1(tm1944) III; aak-2(ok524) X; uthEx202. Show Description
uthEx202 [crtc-1p::crtc-1 cDNA::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.
AGD466 C. elegans uthEx222. Show Description
uthEx222 [crtc-1p::crtc-1 cDNA (S76A, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.
AGD731 C. elegans uthEx299. Show Description
uthEx299 [aak-2 (genomic aa1-aa321)::GFP::unc-54 3'UTR + myo-2p::tdTomato]. Pick animals with red pharynx to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.
AGK573 C. elegans otIs225 II; daf-18(ok480) IV; armEx218. Show Description
otIs225 [cat-4::GFP] II. armEx218 [unc-119p::daf-18 + unc-119p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Transgenic array expresses DAF-18 from unc-119 pan-neuronal promoter; rescues the HSN under-migration phenotype in daf-18 null mutants. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AGK587 C. elegans armEx227. Show Description
armEx227 [pak-1p::NLS::tagRFP + rol-6(su1006)]. Pick rollers to maintain. pak-1p::NLS::tagRFP is expressed primarily in the hypodermal tissue during the comma and 1.5-fold stages, and in the CAN cells at the 3-fold stage through adulthood. Expression can also be seen in additional neurons during the larval and adult stages. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AGK640 C. elegans zdIs13 IV; pak-1(ok448) X; armEx252. Show Description
zdIs13 [tph-1p::GFP] IV. armEx252 [dpy-7p::pak-1::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx252 rescues the pak-1(ok448) HSN under-migration phenotype. pak-1::tagRFP is expressed in the hypodermal tissue throughout development and adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AGK650 C. elegans daf-16(mu86) I; zdIs13 IV; armEx257. Show Description
zdIs13 [tph-1p::GFP] IV. armEx257 [dpy-7p::daf-16b::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx257 rescues the daf-16(mu86) HSN undermigration phenotype. dpy-7p::daf-16b::tagRFP expression is localized to nuclei in hypodermal tissue during the comma, 1.5 and 2-fold stages, becoming cytoplasmic or perinuclear by the 3-fold stage and persisting into adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AML310 C. elegans wtfIs5; wtfEx258. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. wtfEx258 [rig-3p::tagBFP::unc-54 3'UTR]. Pick BFP+ animals to maintain transgene. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons for whole brain imaging. BFP expression from rig-3 promoter allows identification of AVAL/R neurons. Reference: Hallinen KM, et al. eLife. 2021 Jul 29;10:e66135. doi: 10.7554/eLife.66135.
AVS310 C. elegans artEx27. Show Description
artEx27 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion. Broad pattern of developmental GFP expression in the intestine, hypodermal seam cells, and neurons. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AVS413 C. elegans hpk-1(pk1393) X; artEx29. Show Description
artEx29 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion transgene rescues the progeric phenotype of hpk-1(pk1393). Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AX2061 C. elegans dbEx813. Show Description
dbEx813 [gcy-37p::cGi500]. Pick GFP+ animals to maintain. The cGi500 cGMP sensor is expressed in the oxygen-sensing AQR, PQR, and URX neurons. Reference: Couto A, et al. Proc Natl Acad Sci U S A. 2013 Aug 27;110(35):E3301-10.
AX2157 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx722. Show Description
dbEx722 [flp-17p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in BAG. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2159 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx723. Show Description
dbEx723 [gcy-32p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AQR, PQR, and URX. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2161 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx724. Show Description
dbEx724 [flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in ASE using an ASE-specific flp-6p fragment. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2164 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx725. Show Description
dbEx725 [gcy-8p::tax-2(cDNA)::SL2::GFP + gcy-32p::tax-2(cDNA)::SL2::GFP+ flp-17p::tax-2(cDNA)::SL2::GFP + flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD, AQR, PQR, URX, BAG, and ASE. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2178 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx726. Show Description
dbEx726 [gcy-8p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AY145 C. elegans kyIs262 IV; acEx24. Show Description
kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx24 [srbc-48p::srbc-48(cDNA) + unc-122::GFP]. Maintain by picking GFP+ to maintain array. Integrated RFP expression in AWB and AWC. Bright GFP expression in coelomocytes. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
AY146 C. elegans kyIs262 IV; acEx25. Show Description
kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx25 [odr-1p::srbc-48::GFP]. Maintain by picking GFP+ to maintain array. Extra-chromosomal GFP expression in AWC neurons. Integrated RFP expression in AWB and AWC. acEx25 rescues srbc-48 mediated defects. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
AY147 C. elegans acEx26. Show Description
acEx26 [odr-1p::RFP]. Pick RFP+ to maintain. RFP expression in AWC and AWB. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
BA759 C. elegans hcDf1 IV; eEx25. Show Description
eEx25 [C13G4(cosmid) + XDM23(phage)]. Animals with eEx25 are WT. Pick wild-type to maintain. Animals which have lost eEx25 are Twitchers and Sterile (occasionally produce young). This cosmid lacks the 3' end of the unc-22 gene while XDM23 lacks the 5' end of unc-22, but following injection an extrachromosomal array was formed that included at least one functional unc-22 gene.
BB94 C. elegans dcr-1(ok247) III; uuEx20. Show Description
uuEx20 [dcr-1(D145N) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.
BB95 C. elegans dcr-1(ok247) III; uuEx21. Show Description
uuEx21 [dcr-1(G492R) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.
BC20063 C. elegans dpy-5(e907) I; sEx20063. Show Description
sEx20063[rCesF44E5.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC3840 C. elegans sDf69(s2298) unc-22(s7) lev-1(x22)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and dead eggs. Hets twitch in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC4542 C. elegans sEx29. Show Description
sEx29 [ZK652 (III) + pCes1943[rol-6(su1006)]]. Cosmid ZK652 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5038 C. elegans sEx206. Show Description
sEx206 [ZK637 (III) + pCes1943[rol-6(su1006)]]. segrgnt 2. 6 ng/ul ZK637 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5055 C. elegans sEx223. Show Description
sEx223 [BO336 (III) + pCes1943[rol-6(su1006)]]. segrgnt A. 10 ng/ul BO336 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5058 C. elegans sEx226. Show Description
sEx226 [C13B9 (III) + pCes1943[rol-6(su1006)]]. segrgnt C. 20 ng/ul CB13B9 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5062 C. elegans sEx230. Show Description
sEx230 [F57B9 (III) + pCes1943[rol-6(su1006)]]. segrgnt. C. 5 ng/ul F57B9 + 95 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.