Strain Information
Name | RG3028 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | C40H5.7(ve528[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Description | Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
Mutagen | Crispr/Cas9 |
Made by | RG KO Group |
Laboratory | RG |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.