More Fields
Strain Species Genotype
RG3002 C. elegans sra-1(ve502[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
AH159 C. elegans sra-13(zh13) II. Show Description
sra-13(zh13) mutants display stronger chemotaxis to limiting concentrations of isoamylalcohol and diacetyl than WT animals. Deletion allele. 396 bp of 5' promoter sequence and all but the last exon are removed; probably a null allele.
OH1670 C. elegans him-5(e1490) V; otIs123. Show Description
otIs123 [sra-11::GFP + unc-4(+)]. Might contain an unc-4 mutation in the background.
RB816 C. elegans sra-11(ok630) II. Show Description
F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CAGCTCATCCTGCTCAAATG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: GCGATTGTAGATGTCTGGCA. Inner primer WT PCR product: 2267. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB984 C. elegans sra-11(ok898) II. Show Description
F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CTTTGCTCCGCCTATTTGAG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: CACCAACCGGTCTCAATTTT. Inner Primer WT PCR product: 2100. Deletion size: 615 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB985 C. elegans sra-11(ok899) II. Show Description
F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CTTTGCTCCGCCTATTTGAG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: CACCAACCGGTCTCAATTTT. Inner Primer WT PCR product: 2100. Deletion size: 1004 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3010 C. elegans sra-18(ve510[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3011 C. elegans sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3015 C. elegans sra-12(ve515[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
ZM5132 C. elegans hpIs179. Show Description
hpIs179 [sra-11p::D3cpv]. 2.8 kb sra-11 promoter sequence drives Cameleon (a genetically-induced calcium indicator) in AVB, AIA, and AIY head interneurons. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.