Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
CB767 C. elegans bli-3(e767) I. Show Description
Blistered cuticle. Bursae abnormal. Dpy. Males abnormal. M-MATING-NO SUCCESS.
LC74 C. elegans pah-1(ok687) II. Show Description
Superficially WT. Cuticle slightly more resistant to insult than WT. ES1-ES0. Severe cuticle abnormalities in double mutant with bli-3(e767).
MT1344 C. elegans bli-3(e767) lin-17(n677) I. Show Description
MT6183 C. elegans bli-3(e767) unc-54(e1092) I. Show Description
Mapping strain.
NL2331 C. elegans gpa-16(pk481)/bli-3(e767) I. Show Description
Heterozygotes are WT and segregate WT, blistered, and lethals. pk481 previously called spn-1.
RG3267 C. elegans +/mT1 [umnIs52] II; C16C10.8(ve767[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval lethal or sterile. Deletion of 1175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 larvae (ve767 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atggtgtttcatgagaaatgtggctctccc ; Right flanking sequence: TTGACAATCAATACAGCTGAAAGTAGTATT. sgRNA #1: tgaactcacacaatttcacc; sgRNA #2: CTTGTCTACACgtaagcttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.