Strain Information
| Name | NL2336 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | dpy-20(e1282) IV; pkIs1275. |
| Description | pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94. |
| Mutagen | N/A |
| Outcrossed | x0 |
| Made by | Plasterk lab |
| Laboratory | NL |
| Reference | Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94. |
Sign in
or
register an account if you want to order this strain.