Strain Information

Name OD4087   View On Wormbase
Species C. elegans
Genotypecyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V.
DescriptionmNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
MutagenCrispr/Cas9
Outcrossedx0
Made byPablo Lara-Gonzalez
Laboratory OD
Reference PMID: 31588029
Sign in or register an account if you want to order this strain.