Strain Information
Name | OD4087 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. |
Description | mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029. |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | Pablo Lara-Gonzalez |
Laboratory | OD |
Reference | PMID: 31588029 |
Sign in
or
register an account if you want to order this strain.