| MLC2312 |
C. elegans |
che-1(luc174) I. Show Description
Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa // tataatttactgatacaata Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MLC239 |
C. elegans |
mir-790(luc40) IV. Show Description
luc40 is a deletion of mir-790. luc40 mutants respond normally to CO2 as compared to mir-791(lf) animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
| MLC2543 |
C. elegans |
dct-1(luc194) X. Show Description
CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
| MLC349 |
C. elegans |
ttTi5606 II; unc-119(ed3) III; mir-1820(luc16[unc-119(+)]) IV. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-1820 deletion allele; miRNA hairpin replaced by unc-119.
|
|
| MLC425 |
C. elegans |
mir-4813(luc21) III. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-4813 seed mutant: ttcaatat to tGCGCat (introduced FspA1 cutting site) and inserted additional PAM mutation in the upstream region.
|
|
| MLC450 |
C. elegans |
lucSi23 II; henn-1(tm4477) III. Show Description
lucSi23 [rab-3p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
|
|
| MLC528 |
C. elegans |
lucSi28 II; henn-1(tm4477) III. Show Description
lucSi28 [myo-2p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
|
|
| MLC530 |
C. elegans |
lucSi30 II; henn-1(tm4477) III. Show Description
lucSi30 [unc-31p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
|
|
| MLC557 |
C. elegans |
lucSi37 II; henn-1(tm4477) III. Show Description
lucSi37 [rps-5p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
|
|
| MLC559 |
C. elegans |
lucSi39 II; henn-1(tm4477) III. Show Description
lucSi39 [elt-2p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
|
|
| MLC610 |
C. elegans |
cah-3(luc28[3' UTRmutant, delta mir-791 binding sites]) Show Description
luc28 removes mir-791 binding sites in the cah-3 3'UTR. luc28 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
| MLC657 |
C.elegans |
akap-1(luc37) III. Show Description
luc37 removes mir-791 binding sites in the akap-1 3'UTR. luc37 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals, similar to the response of mir-791(lf) animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
| MLC664 |
C. elegans |
lucSi40 II; henn-1(tm4477) III. Show Description
lucSi40 [rgef-1p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
|
|
| MLC698 |
C. elegans |
mir-255(luc38) V. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-255 deletion allele removes the hairpin (breakpoints: aaactttcgttgctgcgaaat...ccattcaattaatttcccgcatttcttaatttttgagctttttctt).
|
|
| MLC749 |
C.elegans |
lucSi61 II; henn-1(tm4477) III. Show Description
lucSi61 [ASEp::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
|
|
| MLC813 |
C. elegans |
tbx-37(luc41[GFP::flex::tbx-37]) tbx-38(tm581) III. Show Description
Wild-type morphology. GFP-tag inserted into endogenous tbx-37 locus by CRISPR/Cas9 engineering. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MLC893 |
C. elegans |
tbx-37(tm314) tbx-38(luc54[GFP::flex::tbx-38]) III. Show Description
Wild-type morphology. GFP-tag inserted into endogenous tbx-38 locus by CRISPR/Cas9 engineering. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MLC900 |
C. elegans |
lucSi91 II; henn-1(tm4477) III. Show Description
lucSi91 [myo-3p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
|
|
| MLC903 |
C. elegans |
nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X, lucIs24. Show Description
lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
|
|
| MOS370 |
C. elegans |
him-5(e1490) V; lite-1(ce314) X; fsIs22; ljIs114. Show Description
fsIs22 [osm-5p::fem-3::mCherry + unc-122p::GFP]. ljIs114 [gpa-13p∷FLPase + sra-6p∷FRT::mCherry::StopCodon::FRT∷ChR2∷YFP]. Him. Pan-ciliated masculinization with ChR2 specifically in ASH. Reference: Pechuk V., et al. 2022, Current Biology 32, 1–14. https://doi.org/10.1016/j.cub.2022.08.038
|
|
| MOS88 |
C. elegans |
him-5(e1490) V; etyIs1. Show Description
etyIs1 [gpa-13p::FLPase + sra-6p::FRT::mCherry::StopCodon::FRT::GCaMP6s]. Him. Integrated ASH-specific calcium sensor transgene. Reference: Pechuk V., et al. 2022, Current Biology 32, 1–14. https://doi.org/10.1016/j.cub.2022.08.038
|
|
| MP108 |
C. elegans |
ndg-4(lb108) III; bus-1(lb201) V. Show Description
lb108 is inseparable from dpy-17(e164). Brood size is less than 25% of wild type. Eggs display a variable pale color. 70-95% of adults survive overnight incubation with 0.5 ug/ul nordihydroguairetic acid.
|
|
| MP125 |
C. elegans |
unc-8(n491) sup-41(lb125) IV; deg-1(u38) X. Show Description
Animals move sluggishly but are able to back, despite n491. lb125 also partially suppresses the tail touch insensitive phenotype of u38 in cold-sensitive fashion: at 25C -> 0%; at 20C -> 5%; at 15C -> 30%.
|
|
| MP140 |
C. elegans |
enu-2(lb140) III. Show Description
Mildly Unc. Adults display progressive vacuolization of body wall muscle. Neither phenotype is suppressed by mec-6(e1342).
|
|
| MP141 |
C. elegans |
sup-43(lb141) II. Show Description
Allele-specific suppressor of unc-8(e49). lb141 single mutant animals are coiler Uncs. Both suppression of e49 and coiling are recessive.
|
|
| MP155 |
C. elegans |
sup-43(lb141) II; unc-8(e49) IV. Show Description
Animals have nearly WT movement. lb141 is an allele-specific recessive suppressor of e49.
|
|
| MQ1766 |
C. elegans |
sod-2(ok1030) I; sod-5 (tm1146) sod-1(tm783) II; sod-4(gk101) III; sod-3(tm760) X. Show Description
Normal lifespan. Increased sensitivity to oxidative stress, osmotic stress, cold stress, and heat stress. Slow development, slow physiological rates (thrashing, defecation), and reduced fertility. van Raamsdonk J & Hekimi S. Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5785-90.
|
|
| MQ228 |
C. elegans |
mad-2(qm62) I. Show Description
Maternal effect dumpy. Adults are short but larvae are not. Animals are lethargic but display hyperactive foraging movement and very rapid pumping when stimulated by light touch. Hermaphrodite and male tails are abnormal. Very slow development. High degree of embryonic and larval lethality.
|
|
| MQD1543 |
C. elegans |
daf-16(hq23[daf-16::GFP]) I. Show Description
GFP tag inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. The GFP fusion tag does not interfere with the function of DAF-16 protein. DAF-16::GFP is expressed ubiquitously in most or all somatic tissues, including neurons, intestine, body wall muscles, and hypodermis, and also in the germ cells and oocytes. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD1661 |
C. elegans |
daf-2(hq61[daf-2::mNeongreen]) III. Show Description
mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. Phenotypic assays have shown that this mNeonGreen tag does not perturb the function of the DAF-2 protein. DAF-2::mNeonGreen is expressed in neurons, XXX cells, vulval cells, germ cells, and oocytes with clear plasma membrane localization as expected for a cell surface receptor.
Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD1779 |
C. elegans |
daf-2(hq63[daf-2::ICR::NLS::gfp::mNeonGreen::NLS]) III. Show Description
Nuclear Ultrabright GFP::mNeonGreen Fluorescent protein (NuGFP) tag inserted downstream of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. NuGFP cassette is composed of an intercistronic region (ICR) from the C. elegans SL2-type operon, a SV40 nuclear localization sequence (NLS), the coding sequence of GFP, the coding sequence of mNeonGreen, and egl-13 NLS. The expression of NuGFP is tied to that of the endogenous daf-2, but after trans-splicing, the NuGFP protein is synthesized independently of DAF-2. This high-sensitivity daf-2 expression reporter was readily detectable in most C. elegans cells throughout development and adulthood.
Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2356 |
C. elegans |
hqSi8 II; daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3'UTR+Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons.
hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2374 |
C. elegans |
ieSi61 II; daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine.
Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2375 |
C. elegans |
daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.
|
|
| MQD2378 |
C. elegans |
hqSi9 II; daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the hypodermis.
hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2379 |
C. elegans |
hqSi10 II; daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the body wall muscles.
hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2383 |
C. elegans |
hqSi11 II; daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the gonadal sheath.
hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2402 |
C. elegans |
daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III; hqSi12 IV. Show Description
hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2428 |
C. elegans |
daf-2(hq363[daf-2::degron::mNeonGreen]) III. Show Description
Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. The double tag of a degron sequence and a fluorescent protein sequence enables facile detection of the expression of the fusion protein and auxin-induced DAF-2 protein degradation. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2433 |
C. elegans |
daf-16(hq389[daf-16::gfp::degron]) I. Show Description
GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.The double tag of a degron sequence and a fluorescent protein sequence enables facile detection of the expression of the fusion protein and auxin-induced DAF-16 protein degradation. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2453 |
C. elegans |
ieSi57 II; daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in somatic tissues. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2490 |
C. elegans |
daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) III. Show Description
Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2491 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in somatic tissues. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2492 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; hqSi8 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3'UTR+Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2493 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; hqSi9 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the hypodermis.
hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2494 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; ieSi61 II; daf-2(e1370) unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2495 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; daf-2(e1370) unc-119(ed3) III; hqSi12 IV. Show Description
hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2498 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; daf-2(e1370) unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the germ line. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2499 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; hqSi10 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the body wall muscles.
hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2500 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; hqSi11 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the gonadal sheath.
hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|