More Fields
Strain Species Genotype
CB57 C. elegans unc-14(e57) I. Show Description
Unc.
DR436 C. elegans dpy-5(e61) unc-14(e57) I. Show Description
Dpy. Unc.
FX11501 C. elegans dpy-5(e61) uri-1(tm939)/dpy-5(e61) unc-14(e57) I. Show Description
Heterozygotes are Dpy. Segregate Dpy Unc. tm939 homozygotes are emb, leth, pvl, rup, larval arrested or sterile. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MT6356 C. elegans dpy-5(e61) nDf43/dpy-14(e188) unc-14(e57) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and animals which arrest as L1 or L2 larvae (nDf43) homozygotes.
YE57 C. elegans smc-5(ok2421)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2421 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok2421 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.
CB572 C. elegans unc-33(e572) IV. Show Description
Paralyzed Unc. Small.
CB576 C. elegans unc-54(e576) I. Show Description
Slow movement.
RG3065 C. elegans +/nT1 [umnIs49] IV; nol-56(ve565[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs.  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tgcgcaaaactgtacCTTCTCCTTAACCTC ; Right flanking sequence: Tggtgtaagaacctgaaaaatcatttattc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3070 C. elegans C25H3.3(ve570[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1006 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gccgcattttggacccaagatttcgcgtct ; Right flanking sequence: acaatttctaatttgatcgttttgaaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3071 C. elegans mlt-2(ve571[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Let. Deletion of 2897 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve571 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gttttcattaaatcaaaatttgtgccacca ; Right flanking sequence: GCAAACCGTCGATctttaagattgtaacat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3072 C. elegans C06E4.6(ve572[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1065 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gagatcaaatacttcttccaagtTTACTGG ; Right flanking sequence: tttaaagtaacaagataggcagacataccc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3073 C. elegans C25D7.16(ve573[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 323 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGTTCAACAATCGATTGAAATTCGTGTTA ; Right flanking sequence: ACCGGCGTTCAGACAGTCTCCACAAAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3074 C. elegans +/nT1 [umnIs49] IV; mcm-3(ve574[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste. Deletion of 2846 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate adults (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tagtacaataggcaatgtaaaatcaatgtg ; Right flanking sequence: cggggaaaatagaaaaattcggcccaaatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3075 C. elegans C25E10.16(ve575[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1085 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: taaggtagcaccatcgaaaaaaaacctcat ; Right flanking sequence: tgtgggttggtatggagaattggagacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3076 C. elegans anat-1(ve576[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 9928 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtctctttctattttaccttctttccggca ; Right flanking sequence: tgtcccaatttcacattattatatattttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3077 C. elegans +/mT1[umnIs52] II; bcas-2(ve577[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Pvul GFP+ non-mKate2 adults (ve577 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaatccaaaaTCAGTTCTCCTGATCCTCTT ; Right flanking sequence: GTAAGTGCTAACGGTTTGGAGCTCATcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3078 C. elegans +/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. Show Description
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygous Let. Deletion of 2704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve578 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttaacacccgtatcattatcatttccatgc ; Right flanking sequence: cccaacttccttccaccccctcaaaaagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3079 C. elegans bmy-1(ve579[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Mel. Deletion of 694 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 that give dead progeny (ve579 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ataatgtttcgcaatgctctcctttcctac ; Right flanking sequence: GAAGGACAGAGCTTTGACGGACCTGCGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3083 C. elegans copz-1(ve583[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Emb. Deletion of 898 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead eggs (ve579 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atcggctcgtaaatctacacgaaaacctag ; Right flanking sequence: CACAAATCGGCTTCTCGTTCATGAAATCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
UP3666 C. elegans lpr-3(cs250[ssSfGFP::lpr-3]) X?. Show Description
Endogenous lpr-3 locus tagged with ssSfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
UP3746 C. elegans let-653(cs262[let-653::SfGFP]) IV. Show Description
Endogenous let-653 locus tagged with SfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
UP3756 C. elegans let-4(cs265[ssmCherry::let-4]) X. Show Description
Endogenous let-4 locus tagged with mCherry using CRISPR/Cas9. mCherry expression is faint. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.