| CB2233 |
C. elegans |
unc-69(e587) dpy-18(e364) III. Show Description
UncDpy.
|
|
| CB587 |
C. elegans |
unc-69(e587) III. Show Description
Unc. Recessive. M-MATING-NO SUCCESS.
|
|
| DG728 |
C. elegans |
sma-2(e502) emb-30(tn377) ced-7(n1892) unc-69(e587) III. Show Description
Temperature sensitive emb-30 allele. Maintain at 15C. Small. Unc. Cell death abnormal.
|
|
| DG796 |
C. elegans |
sma-2(e502) tnDf2/sma-2(e502) ced-7(n1892) unc-69(e587) III. Show Description
Heterozygotes are SmaCed and segregate SmaCed, SmaCedUnc and dead eggs. Maintain by picking SmaCed. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).
|
|
| DG801 |
C. elegans |
unc-32(e189) tnDf2/sma-2(e502) ced-7(n1892) unc-69(e587) III. Show Description
Heterozygotes are Ced and segregate Ced, dead eggs and SmaCedUncs. Maintain by picking Ced. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).
|
|
| EU2936 |
C. elegans |
unc-69(e587) klp-7(or1092) III. Show Description
Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
|
|
| JK1313 |
C. elegans |
lin-12(n941) glp-1(q46)/dpy-19(e1259) unc-69(e587) III. Show Description
Heterozygotes are WT and segregate WT, Dpy(ts) Uncs, and Lag L1 lethals (not ts). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| JK1389 |
C. elegans |
mog-1(q223) unc-69(e587)/eT1 III; +/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT4925 |
C. elegans |
glp-1(q231) ced-7(n1892) unc-69(e587) III. Show Description
Maintain at 15C. glp-1(q231) is temperature sensitive. Unc. ced-7(n1892) causes persistent cell corpes and has a maternal effect.
|
|
| MT4996 |
C. elegans |
sma-2(e502) ced-7(n1892) unc-69(e587) III. Show Description
|
|
| MT5523 |
C. elegans |
unc-69(e587) ced-9(n1950n2161)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Uncs and DpySte. n2161 is an intragenic revertant of ced-9(n1950). The unc-69 ced-9 homozygotes have a maternal effect lethal phenotype: their offspring arrest as embryos or L1; they also give very few eggs at 25C.
|
|
| MT7554 |
C. elegans |
sqv-3(n2842) unc-69(e587)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Sqv Uncs. n2842: mid-L4 vulva abnormal, sterile.
|
|
| NJ582 |
C. elegans |
cul-1(e1756)/unc-69(e587) III. Show Description
Heterozygotes are WT and segregate WT, Unc and Long Thin Steriles (that arrest before the adult stage). cul-1 animals have excess cell divisions in post-L1 blast cell lineages. cul-1 was formerly known as lin-19.
|
|
| RG3087 |
C. elegans |
dad-1(ve587[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 699 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve587 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gtgtaacacagcaagagaaacgaaacccca ; Right flanking sequence: TTTGGTAGTCATCGAACAGTTTCGAGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|