Strain Information
Name | MLC1776 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | tbx-43(luc131) III. |
Description | Wild-type morphology. CRISPR/Cas9 engineered 952 bp deletion of the tbx-43 locus. Flanking sequence: aattagtttttagctccagaagtcggggccgcgccacgttgcatgctcgg / ggcgcttatggaaaaatcattgtggcgggaattcgattcgcagtgtaatg Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421 |
Mutagen | No mutagen |
Outcrossed | x0 |
Made by | Julien Charest |
Laboratory | MLC |
Reference | Charest & Daniele et al. (2020). Combinatorial Action of Temporally Segregated Transcription Factors. Developmental Cell. |
Sign in
or
register an account if you want to order this strain.