Strain Information
| Name | MLC1946 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | tbx-11(luc144) III. |
| Description | Wild-type morphology. CRISPR/Cas9 engineered 1.3 kb deletion of the tbx-11 locus. Flanking sequence: aaaaataacaaaataacaaggaatgagaagggaaaacaggaaaaatacac / ttgccacgtgttgggcgggaaaacgcgtagtcatccggcaggtgtaacct Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421 |
| Mutagen | No mutagen |
| Outcrossed | x0 |
| Made by | Josef Röhsner |
| Laboratory | MLC |
| Reference | Charest & Daniele et al. (2020). Combinatorial Action of Temporally Segregated Transcription Factors. Developmental Cell. |
Sign in
or
register an account if you want to order this strain.