Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MT3213 C. elegans dpy-5(e61) sem-4(n1378) I. Show Description
Dpy. Egl. Transformation of sex myoblasts into body wall muscle.
MT3751 C. elegans dpy-5(e61) I; rol-6(e187) II; unc-32(e189) III. Show Description
MT465 C. elegans dpy-5(e61) I; bli-2(e768) II; unc-32(e189) III. Show Description
Mapping strain. DpyUnc.
MT6356 C. elegans dpy-5(e61) nDf43/dpy-14(e188) unc-14(e57) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and animals which arrest as L1 or L2 larvae (nDf43) homozygotes.
MT6550 C. elegans lam-3(n2561)/dpy-5(e61) unc-75(e950) I. Show Description
Heterozygotes are WT. Segregate Dpy Uncs. Segregate L1 lethal: starved, uncoordinated, defective pharyngeal basement membrane.
MT7026 C. elegans mek-2(n2679)/sup-11(n403) dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, steriles with a vulval defect, and scrawny Dpys. n2679 is a suppressor of let-60(n1046) Muv, and is recessive sterile with vulval defects. n267 is an intermediate strength allele. See also WBPaper00002150.
MT8667 C. elegans mek-2(n2678)/sup-11(n403) dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, Sterile Vuls and scrawny Dpys. n2678 is a suppressor of let-60(n1046) Muv. n2678 animals are Vul and recessive sterile. n2678 is a strong allele, probably null. See also WBPaper00002150.
MT8840 C. elegans dpy-5(e61) lin-53(n833) I. Show Description
Dpy. n833 is a synthetic Muv with lin-15A(n767).
NG2837 C. elegans dpy-5(e61)/unc-73(gm40) I. Show Description
Heterozgyotes are WT and segregate WT, Dpys and Uncs. Recombination occurs in this strain so pick individual WT animals and score the progeny for both Dpys and Uncs.
PH32 C. elegans che-3(hf5) dpy-5(e61) I. Show Description
Dpy. Resistant to caffeine. Previously called caf-2(hf5).
RW1383 C. elegans unc-38(x20) pat-10(st568)/unc-38(x20) dpy-5(e61) I. Show Description
Heterozygotes are Unc non-Dpy and segregate Unc non-Dpy, DpyUnc and PATs. st568 is a recessive lethal causing a PAT phenotype (paralyzed embryoes, arrested elongation at 2-fold length).
RW3518 C. elegans pat-11(st541)/dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, Dpys and embryos which arrest at the 2-fold stage.
SD63 C. elegans dpy-5(e61) unc-13(e51) I; gaDp1 (I;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. Maintain by picking WT.
SP24 C. elegans dpy-5(e61) unc-54(e190) I. Show Description
DpyUnc.
SS262 C. elegans mes-3(bn35) dpy-5(e61) I; sDp2 (I;f). Show Description
Animals with the Duplication have a WT phenotype. Animals which have lost the Duplication are Dpy and give sterile Dpy progeny. Strict maternal effect sterile. Sterile worms have a dramatic reduction in number of germs cells (10-100 fold less than WT). See also WBPaper00002343.
TB1 C. elegans ceh-6(mg60)/dpy-5(e61) unc-29(e1072) I. Show Description
ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.
VJ311 C. elegans erm-1(tm677)/unc-63(x18) dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and erm-1 homozygotes which grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
VT581 C. elegans dpy-5(e61) lin-28(n719) I; lin-46(ma164) unc-76(e911) V. Show Description
Dpy Unc. Egl+. lin-46 suppresses precocious Egl- phenotype of lin-28. lin-46 alone makes gaps in adult alae; enhanced at 15C.
WM149 C. elegans dpy-5(e61) unc-13(e51) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segragate WT GFP+, arrested hT2 aneuploids, and non-GFP Dpy Unc homozygotes. Homozygous hT2[bli-4 let-? qIs48] are inviable.
ZT72 C. elegans dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZZ1004 C. elegans unc-63(x18) dpy-5(e61) I. Show Description
ZZ1012 C. elegans unc-74(x19) dpy-5(e61) I. Show Description
ZZ1015 C. elegans unc-38(x20) dpy-5(e61) I. Show Description
CB611 C. elegans unc-23(e611) V. Show Description
Head abnormal. Variable expression. M-MATING+++ 10-30%WT.
RG3110 C. elegans rpt-4(ve610[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sqt-2(sc3) II. Show Description
Homozygous larval arrest. Deletion of 1568 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ ve610 homozygotes (larval arrest) and non-Rol non-GFP adults (sc3 homozygotes). Maintain by picking Rol GFP+ adults. Left flanking Sequence: aaaaattactataatatttcgcgatttttt ; Right flanking sequence: aggaaagaacgtcagaaatgaaaatcagaa. rpt-4 sgRNA #1: ttacgaggctcgtcattatt; rpt-4 sgRNA #2: gaaaaaacgaggttctcatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3111 C. elegans F56C11.5(ve611[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Mel. Deletion of 3345 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that lay dead eggs (ve611 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: GATCAATCGCTGGTCCAGAAGGTTCCACTA ; Right flanking sequence: TCAGGCCACCGATTTTTAGtctatatttta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3112 C. elegans gcsh-2(ve612[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve612 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: CATACTGTTCCTCGTTAAGAAGTTTTTCCA ; Right flanking sequence: agggcaatgattgtcttggagttttttttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3113 C. elegans col-133(ve613[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3100 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggagtacacggaagaagatgcaatgataaa ; Right flanking sequence: gatcgtagcgagacccactctgaaaaaccg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3114 C. elegans col-154(ve614[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1367 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aagagggaggatgaacagcgggcggtgcca ; Right flanking sequence: acattttgaaaaaaaagctcgagaacgagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3115 C. elegans vha-11(ve615[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)]. Show Description
Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP unc-5(tm9708) homozygotes, and GFP+ dead embryos(ve615).
RG3116 C. elegans +/mT1[umnIs52] II; rpl-23(ve616[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve616 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaacaacagcTTAAGCGATGGATCCAGCG ; Right flanking sequence: CGTCCTCTCTTCGACATtttacctgaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3117 C. elegans +/mT1[umnIs52] II; dars-1(ve617[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1747 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve617 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATGGTAACTCGCTCAAGTCCGATGCCTCCT ; Right flanking sequence: TGGAGAGTTTTGGTTGTTCACCTTCGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3118 C. elegans col-155(ve618[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1138 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaattctgaatcatatatttttcaatcat ; Right flanking sequence: gtattgcaattacacttggcagatgcaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3119 C. elegans +/mT1[umnIs52] II; cpf-2(ve619[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1981 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve619 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTCTCTTCAACTGCTGTCTCAGCTCTATT ; Right flanking sequence: tagctccacccacattttttgtgacgtcac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.