More Fields
Strain Species Genotype
KG2730 C. elegans clu-1(ok2). Show Description
Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype more severe than ok3. ok2 is a 1189 bp deletion (III:9519159-9520346) removing amino acids 314-693 and inserting a glutamic acid at the deletion site. Flanking sequence: GACCGACTTCCAACCAGTTACCCAG...ATGTTATGAAGTTCAATCCGGATTGTTTCTC ATCAAATGT.
KG2731 C. elegans clu-1(ok3). Show Description
Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype less severe than ok2. ok3 is a 1047 bp deletion (III:9518654-9519699) and 13 nucleotude insertion (producing two termination codons) resulting in a protein truncated at amino acid 693 plus an inserted glutamic acid. Flanking sequence: GCTCGAGGATGCTGCTCACAAACTGAAAATG...GAATAGTATCCGTGAATAGTATCCG TGAAGATTCTG.
AC365 C. elegans sao-1(ok3335) V. Show Description
Derived by outcrossing parental strain RB2429 six times to N2, followed by recombining flanking chromosome to the right and left by recombining on, and then off rol-4(sc8) and unc-76(e911). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057.
AV276 C. elegans syp-2(ok307) V/nT1 [unc-?(n754) let-?(m435)] (IV;V). Show Description
Balanced heterozygotes are Unc and segregate Unc (heterozygotes), non-Unc syp-2(ok307) homozygotes, and dead eggs (nT1 homozygotes). syp-2(ok307) homozygotes are viable and non-Unc. They produce 96% dead eggs and 44% males; cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes.
BS3493 C. elegans gld-3(ok308)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok308 homozygotes (mostly sterile or Mel, but can be slowly propagated at 20C). Pick WT dim GFP and check for correct segregation of progeny to maintain.
CB7007 C. elegans ilys-3(ok3222) IV. Show Description
Viable, but defective in bacterial grinding and hypersensitive to bacterial pathogens. Derived by out-crossing parental strain VC2496. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
CB7172 C. elegans ilys-3(ok3222) IV; lys-7(oj1385) V. Show Description
Viable, poor bacterial grinding, increased sensitivity to bacterial pathogens. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
CB7173 C. elegans ilys-3(ok3222) IV; ilys-5(tm3151) X. Show Description
Viable, but with poor bacterial grinding and increased susceptibility to some bacterial pathogens. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
COP1635 C. elegans nas-38(knu579 ok3407) X. Show Description
Specific in-frame deletion of the astacin domain in ok3407 background suppresses increased quiescence from the ok3407 allele. Quiescence behavior in this strain is reverted to wild-type. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
CX11839 C. elegans tyra-3(ok325) X. Show Description
Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX13079 C. elegans octr-1(ok371) X. Show Description
Derived by outcrossing VC224 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX13325 C. elegans inx-2(ok376) X. Show Description
Derived by outcrossing VC260 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX14295 C. elegans pdfr-1(ok3425) III. Show Description
Decreased locomotion on food. Derived by outcrossing VC2609 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CZ17515 C. elegans juSi94 II; rps-18(ok3353) IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18018 C. elegans juSi94 II; rps-18(ok3353) IV; juEx5375. Show Description
juSi94 [rps-18p::GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5375 [col-19p::GFP(1-10) + ttx-3p::RFP]. Pick RFP+ to maintain. Expression of split GFP reporter labels ribosomes in the epidermis. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
CZ18020 C. elegans juSi94 II; rps-18(ok3353) IV; juEx5377. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5377 [myo-3p::GFP1-10 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. Muscle-specific expression of split GFP reporter allows visualization of ribosomes in muscle. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18412 C. elegans juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18637 C. elegans juSi83 II; rps-18(ok3353) IV/nT1[qIs51] (IV;V). Show Description
juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ19297 C. elegans juSi94 II; rps-18(ok3353) juIs409 IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ19299 C. elegans juSi94 juIs438 II; rps-18(ok3353) IV. Show Description
juIs438 [mec-4p::GFP(1-10) + mec-4p::tagRFP] II. juSi94 [rps-18p::GFP11::rps-18]. Expression of split GFP reporter labels ribosomes in touch neurons. Generated in N2 background. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ20132 C. elegans juSi94 II; rps-18(ok3353) IV; juIs463. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. DD motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in those neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ29001 C. elegans muIs32 II; degt-1(ok3307) V. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]
CZ3086 C. elegans kin-1(ok338)/unc-54(r293) I. Show Description
Heterozygotes are WT and segregate WT, Unc, and early larval lethal.
DA1814 C. elegans ser-1(ok345) X. Show Description
F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.
DA2109 C. elegans ser-7(tm1325) ser-1(ok345) X. Show Description
F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.
DG3393 C. elegans kin-1(ok338) I; tnEx109. Show Description
tnEx109 [kin-1(+) + sur-5::GFP]. Segregates GFP+ fertile animals and GFP- kin-1(ok338) animals (early larval lethal). Reference: Kim S, et al. 2012 Genetics
EG2710 C. elegans unc-57(ok310) I. Show Description
T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu
EJ810 C. elegans F25H2.5(ok314)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III; him-8(e1489) IV. Show Description
Him. Heterozygotes are WT and segregate WT, Sterile Evul and Dpys.
GS3754 C. elegans sel-13(ok303) III; arIs51 IV; sel-7(n1253) unc-3(e151) X. Show Description
arIs51[cdh-3::GFP]. sel-13=T04A8.10. Reported strong daf-c; raise at 15 C (personal communication to the CGC). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GW1482 C. elegans bqsi433 II; bqSi495 cec-4(ok3124) IV; ygIs1. Show Description
bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421
GW1483 C. elegans bqSi447 II; bqSi495 cec-4(ok3124) IV; ygIs1. Show Description
bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421
GW829 C. elegans gwIs39 III; cec-4(ok3124) IV; gwIs4 X. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs4 [baf-1p::GFP-lacI::let-858 3Â’UTR + myo-3p::RFP] X. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. PMID: 26607792
GW833 C. elegans cec-4(ok3124) IV; gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
HA2825 C.elegans smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. Show Description
rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
JH1521 C. elegans puf-8(ok302) II. Show Description
100% Sterile at 25C. Him and 50% Emb at 20C. Maintain at 15C.
JK3203 C. elegans puf-7(ok397) IV. Show Description
B0273.2. External left primer: AAGCATACAGGCGCAGAGAT. External right primer: TACCGTATTGTGGTGCGAAA. Internal left primer: AACGGTTGCTCATCTGACTT. Internal right primer: AAAATTGCGTCGATTTTTGG. Internal WT amplicon: 2701 bp. Deletion size: 1751 bp. Deletion left flank: TTAAAACTTCTAATTTAAATAAAAAATATA. Deletion right flank: TATGTCGTTCAGCAAATGATTTCGATTTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
KW2211 C. elegans ckSi26 I; cdk-12(ok3664)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).
KW2214 C. elegans ckSi6 I; cdk-12(ok3664). Show Description
ckSi6 [cdk-12::GFP + unc-119(+)] I. ckSi6 rescues cdk-12(ok3664). GFP expressed in all nuclei. Reference: Bowman EA, et al. Development. (In Press).
KX15 C. elegans ife-2(ok306) X. Show Description
No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).
KX17 C. elegans ife-4(ok320) X. Show Description
C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).
LC35 C. elegans cat-4(ok342) V. Show Description
T21C9.2, F32G8.6. Serotonin-deficient by anti-serotonin staining. Bleach hypersensitive. Likely also dopamine-deficient (but not tested). Slightly sickly. External left primer: TTTCTTTTCTTGTTGCGCCT. External right primer: TCGAAAAAGTCTGCTTCGGT. Internal left primer: CGTCTTCCGTTTCTTTTTCG. Internal right primer: TCTTGGAATGTGGGATGTGA. Internal WT amplicon: 2497 bp. Deletion size: 2238 bp. Deletion left flank: CGACTAGATTGATTTCCTTCTGTCCCTTCA. Deletion right flank: CTTGACGGAACAACGCCTCGATCTGATCTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
LM99 C. elegans smn-1(ok355) I/hT2 [bli-4(e937) qIs48] (I;III). Show Description
C41G7.1. smn-1 homozygotes arrest as larvae. Segregates WT glowing hets, non-glowing arrested larvae, very rare homozygous hT2 glowing animals, and dead eggs (aneuploids). URL: http://www.celeganskoconsortium.omrf.org.
MT12755 C. elegans ceh-32(ok343) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. ok343 is lethal or has a linked lethal.
NL4517 C. elegans alg-2(ok304) II; pkIs2256. Show Description
pkIs2256 [alg-2::HA + rol-6(su1006)]. Rollers.
NM4337 C. elegans rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. Show Description
rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.
NM4431 C. elegans rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. Show Description
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.
OH11462 C. elegans swsn-2.2(ok3161) I; otEx5094. Show Description
otEx5094 [swsn-2.2p::swsn-2.2::mChopti + ttx-3::GFP]. Pick GFP+ to maintain. ok3161 homozygotes arrest in early larval development. otEx5094 rescues lethality, but animals are still somewhat sick at 25C.
OK39 C. elegans cuIs2 IV. Show Description
cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Rollers.
PE867 C. elegans pink-1(ok3538) II; feIs4 V. Show Description
feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. Rollers. Strain expresses firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C) in the pink-1(ok3538) mutant background. It is rendered bioluminescent when it ingests D-luciferin. References: Lagido, C, et. al. (to be submitted to bioRxiv). Novel HTS platform for the identification of drugs active in the modulation of mitochondrial function in age-related diseases.
PE868 C. elegans pink-1(ok3538) II; feIs5 X. Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. Rollers. Strain expresses firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C) in the pink-1(ok3538) mutant background. It is rendered bioluminescent when it ingests D-luciferin. References: Lagido, C, et. al. (to be submitted to bioRxiv). Novel HTS platform for the identification of drugs active in the modulation of mitochondrial function in age-related diseases.