Search Strains

More Fields
Strain Species Genotype Add
AA107 C. elegans nhr-48(ok178) X. Show Description
ZK662.3 Homozygous. No obvious phenotype. Outer left primer sequence: TCTGAAGTTTGTGAGCCGTG. Outer right primer sequence: AGCGCCTAGATGAGCAACAT. Inner left primer sequence: TCCGTTGAATGCCATCTGTA. Inner right primer sequence: GGACGATGCACATGAGTTTG. Inner primer PCR product length: 3324 bp. Deletion size: 1956 bp.
ABR212 C. elegans acd-1(sta6) delm-2(ok1822) I. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
ABR225 C. elegans acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
AC456 C. elegans aph-1(tm4743)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygous. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4743 homozygotes (Egl, Mel, adult-onset sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Only heterozygous animals should propagate. aph-1(tm4743) deletion allele was generated by the National BioResource Project of Japan, part of the International C. elegans Gene Knockout Consortium. Reference: Brinkley DM, et al. Genetics. 2024 Jul 8;227(3):iyae076. doi: 10.1093/genetics/iyae076. PMID: 38717968.
AC552 C. elegans aph-2(tm6471)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygous. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4743 homozygotes (Egl, Mel, but do not display adult-onset sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Only heterozygous animals should propagate. aph-2(tm6471) deletion allele was generated by the National BioResource Project of Japan, part of the International C. elegans Gene Knockout Consortium. Reference: Brinkley DM, et al. Genetics. 2024 Jul 8;227(3):iyae076. doi: 10.1093/genetics/iyae076. PMID: 38717968.
AC722 C. elegans aph-2(ik7)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygous. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ik7 homozygotes (Egl, Mel, but do not display adult-onset sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Only heterozygous animals should propagate. aph-2(ik7) is a CRISPR-engineered full deletion of the aph-2 gene (3321 bp deletion). Reference: Brinkley DM, et al. Genetics. 2024 Jul 8;227(3):iyae076. doi: 10.1093/genetics/iyae076. PMID: 38717968. aph-2(ik7) is the first full deletion of the aph-2 gene (3321 bp deletion); it was generated by CRISPR/Cas9, as described in Brinkley et al. 2024 Homozygous aph-2(ik7) animals are Egl and Mel and do not display adult-onset sterility (see Brinkley et al, 2024). Only heterozygous animals from this strain will propagate.
AE501 C. elegans nhr-8(ok186) IV. Show Description
Approx. 1.3 kb deletion - does not remove entire coding region, might not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals.
AG151 C. elegans cdc-25.1(nr2036)/dpy-5(e61) unc-13(e450) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and adult steriles. Original deletion from Axys Pharmaceuticals.
AG247 C. elegans tyms-1(tm2429) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm2429 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
AG248 C. elegans mus-101(tm1761) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm1761 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
AG406 C. elegans pezo-1(av144) IV. Show Description
av144 is a CRISPR/Cas9 engineered deletion in the N-terminal region of pezo-1 removing exons 1–13. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.
AG416 C. elegans pezo-1(av149) IV. Show Description
av149 is a CRISPR/Cas9 engineered deletion in the C-terminal region of pezo-1 removing the last seven exons (27–33) and introns. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.
AGK233 C. elegans unc-119(ed3) III; niDf199 IV; armEx58. Show Description
armEx58 [WRM0611aH08-Del8mer + unc-119(+)]. Pick non-Unc to maintain. This strain contains a transgenic array that expresses a derivative WRM0611aH08 fosmid. The WRM0611aH08 fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. This derivative fosmid construct lacks the upstream 8-mer motif (CTGTTTCA) next to 21U-3372. The expression of this individual 21U-RNA is lost in transgenic animals. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AGK234 C. elegans unc-119(ed3) III; niDf199 IV; armEx53. Show Description
armEx53 [WRM0611aH08 + unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. This strain contains a transgenic array that expresses the WRM0611aH08 fosmid construct. This fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. Expression of this fosmid construct in JU258 worms restores the expression of the missing 21U-RNAs in the germline, as measured by RT-qPCR. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AGK532 C. elegans unc-119(ed3) III; niDf199 IV; armEx196. Show Description
armEx196 [mex-5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to deletion of the niDF199 locus. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AH102 C. elegans lip-1(zh15) IV. Show Description
Deletion allele which removes exons 2 to 6 of lip-1 (C05B10.1). Incompletely penetrant ovulation defect.
AH159 C. elegans sra-13(zh13) II. Show Description
sra-13(zh13) mutants display stronger chemotaxis to limiting concentrations of isoamylalcohol and diacetyl than WT animals. Deletion allele. 396 bp of 5' promoter sequence and all but the last exon are removed; probably a null allele.
AH205 C. elegans sdn-1(zh20) X. Show Description
Slightly Unc. Variably Egl. zh20 is a deletion in sdn-1. The sequence of the breakpoint is: TTTGCTTCACAC//zh20//GTCGACAGGCAG.
AML508 C. elegans unc-31(wtf502) IV; otIs669 V; wtfIs145; wtfIs348. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. unc-31(wtf502) is a CRISPR-engineered deletion allele. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. Reference: Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938.
AUM1747 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz146[PAZ deletion]) I. Show Description
282bp deletion (247aa-345aa) in PAZ domain of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1830 C. elegans sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
AUM1863 C. elegans sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
AV51 C. elegans me8 X. Show Description
Homozygotes produce 10-15% XO male self progeny; nondisjuction is correlated with an increased frequency of achiasmate X chromosomes in oocyte nuclei, and an unaltered distribution of X chromosome crossovers. Heterozygotes produce 1-2% male self-progeny. Homozygotes (and XO hemizygotes) are slower growing than WT; reduced male mating efficiency. me8 disrupts the function of the cis-acting X chromosome meiotic pairing center. Molecular studies show that the me8 chromosome carries a terminal deletion that removes >70 kb from the left end of the X chromosome, including the endogenous telomere; further, a segment of chromosome V has been translocated to the left end of X, and a new telomere has been added de novo to the end of the translocated segment.
AY161 C. elegans mul-1(syb1027) IV. Show Description
F49F1.6. mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9-engineered ?1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Derived by out-crossing parental strain PHX1027 (Suny Biotech) with N2 six times. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
AY162 C. elegans mul-1(syb1027) IV; acEx162. Show Description
acEx162 [mul-1p::mul-1::SL2::GFP + myo-2p::mCherry]. Pick mCherry+ to maintain. GFP expression in the intestine. acEx162 transgene rescues mul-1(lf). mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9 ?1,650-bp deletion mutant of isoforms A and B (565?bp and 952?bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
BA1069 C. elegans F26F4.8(hc180) III. Show Description
Deletion allele of F26F4.8. Homologous to Zn finger of Drosophila ovo transcription factor. Developmental defects in hind gut, germline and vulva. HES primers 106/107 outer and HES 108/109 inner.
BA1070 C. elegans cdh-5(hc181) IV. Show Description
Deletion allele of F08B4.2. Homologous to Drosophila fat cadherin. Primers HES 114/115 outer and HES 116/117 inner.
BA1073 C. elegans dyf-5(hc183) I. Show Description
Deletion allele of M04C9.5 (mak-kinase). No visible phenotype in hermaphrodites. Primers HES 186/187 outer and HES 188/189 inner.
BA1083 C. elegans F43G6.6(hc184) II. Show Description
Deletion allele of F43G6.6. No obvious phenotype in hermaphrodites. HES primers 162/163 outer and 164/165 inner.
BA1084 C. elegans F09C12.2(hc185) II. Show Description
Deletion allele of F09C12.2. No obvious phenotype in hermaphrodites. HES primers 122/123 outer and HES 124/125 inner.
BA1090 C. elegans cav-2(hc191) V. Show Description
No visible phenotype in hermaphrodites. Deletion allele of C56A3.7.
BC4095 C. elegans sDf88(s2074) IV. Show Description
PCR used to establish that s2074 is a deletion. Twitcher.
BC4586 C. elegans unc-76(e911) rol-9(sc148)/sC4(s2172) [dpy-21(e428)] V. Show Description
Heterozygotes are WT and segregate WT and Unc Rollers. sC4(s2172) is not viable as a homozygote. As a heterozygote it reduces recombination between unc-76 and rol-9 to 1.8%. Note: This strain has been sequenced and the sC4 balancer contains a large deletion from V:16,060,619 to V:19,331,432 that removes 1,279 genes and has a complex rearrangement on LGIV. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9
BK530 C. elegans ifc-2(qp110) X. Show Description
Large cysts in excretory canal, sometimes visible with dissecting microscope. qp110 deletion removes part of promoter and first 2 bases of start codon of ifc-2. Deletion of bases 650114 ttttctagggtcctcatcacaaAT 650091 of Chr X (Wormbase WS297 release). Reference: Al-Hashimi H, et al. Genetics. 2018 Oct;210(2):637-652. doi: 10.1534/genetics.118.301078. PMID: 29945901.
BK585 C. elegans exc-9(qpIs124[gfp::3xFlag::exc-9]) IV; ifc-2(rh247) X. Show Description
GFP::3xFlag tag inserted at N-terminus of endogenous exc-9 locus. Large cysts in excretory canal, sometimes visible with dissecting microscope, due to loss of intermediate filament-like protein IFC-2 (formerly called EXC-2). Canals labeled with GFP and 3xFlag. GFP::3xFlag tag was inserted with repair of qp130 deletion in parental strain BK596. Derived by crossing parental strains BK583 x NJ678 and selecting for canal cysts and fluorescence. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501.
BK587 C. elegans exc-9(qpIs124[gfp::3xFlag::exc-9]) IV; ifa-4(ok1717) X. Show Description
GFP::3xFlag tag inserted at N-terminus of endogenous exc-9 locus. Large cysts in excretory canal, sometimes visible with dissecting microscope, due to loss of intermediate filament IFA-4. Canals labeled with GFP and 3xFlag. GFP::3xFlag tag was inserted with repair of qp130 deletion in parental strain BK596. Derived by crossing parental strains BK583 x VC1221 and selecting for canal cysts and fluorescence. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501.
BK588 C. elegans exc-9(qpIs124[gfp::3xFlag::exc-9]) IV; ifa-4(qpIs112[mKate2::3xmyc::ifa-4]) X. Show Description
mKate2::3xMyc tag inserted at N-terminus of endogenous ifa-4 locus. GFP::3xFlag tag inserted at N-terminus of endogenous exc-9 locus. GFP::3xFlag tag was inserted with repair of qp130 deletion in parental strain BK596. Strong mKate2 signal at lumenal surface of excretory canal cell lumen and along entire canal lengths. Canals labeled with GFP and 3xFlag. Derived by crossing parental strains BK583 x BK532 and selecting for canal cysts and both GFP and mKate fluorescence. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501.
BK590 C. elegans exc-9(qpIs126[mKate2::3xMyc::exc-9]) IV. Show Description
mKate2::3xMyc tag inserted at N-terminus of endogenous exc-9 locus. Canals labeled with mKate2 and 3xMyc. Tag was inserted with repair of qp130 deletion in parental strain BK596. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501.
BK596 C. elegans exc-9(qp130) IV. Show Description
CRISPR-induced deletion of bases -1 through +8 of coding region to create a knockout allele of exc-9. Large cysts in excretory canal, sometimes visible with dissecting microscope. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501.
BN3 C. elegans vrk-1(ok1181)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.
BN358 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strain XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BN359 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502. Show Description
qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BN360 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502; ojIs1. Show Description
ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BN40 C. elegans npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
BN53 C. elegans vrk-1(ok1181)/mIn1 [mIs14 dpy-10(e128)] II; vrIs13. Show Description
vrIs13 [vrk-1p::VRK-1:GFP:VRK3UTR + unc-119(+)]. F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.
BN69 C. elegans npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II; bqIs51 ltIs37 IV. Show Description
bqIs51 [pie-1p::GFP::npp-5 + unc-119(+)] IV. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Expresses GFP::NPP-5 and mCherry in the germ line. Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl; bqIs51 transgene rescues the npp-5(tm3039) phenotype. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT with dim GFP in the pharynx and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
BN85 C. elegans npp-5(ok1966)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. ok1966 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
BP600 C. elegans aff-1(tm2214) II. Show Description
A 1.2 kb deletion in aff-1 (C44B7.3) which introduce stop codon after alanine 47. AFF-1 is a type I membrane protein necessary and sufficient for specific cell fusion events during embryonic and larval development. Temperature sensitivity was not detected. At 20° the fusion of hyp5 in the embryo does not occur as well as anchor cell (AC) fusion, vulval cells fusion of the A and D rings and the terminal fusion between the seam cells late in L4. 6% L1 rod-like lethal and 0% embryonic lethal. Adults are completely Egl, and partially Unc, Pvl. In addition, only 2% of AC in the mutant worms undergo fusion. These animals give very low brood size (16 progeny per worm) and 3.4% of the worms are sterile. This strain gives very small brood size and hence grows slowly. Originally from Shohei Mitani, Tokyo Women's Medical College, Tokyo, Japan.
BR2815 C. elegans nep-1(by159) II. Show Description
1450 bp deletion. Deletion removes 245 bp of promoter, 1st exon and 2nd exon.
BR2823 C. elegans chn-1(by155) I. Show Description
989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.