Search Strains

More Fields
Strain Species Genotype Add
JK6011 C. elegans lst-1(q1032[*q1004]) I. Show Description
q1004[LST-1::3xV5] is the CRISPR-engineered insertion of a 3xV5 tag at the C-terminus of the endogenous lst-1 locus. q1032 is the CRISPR-engineered mutation C260S & C263S in the Zn finger domain of LST-1 (Haupt et al., 2019) in the q1004 background. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205.
JK6045 C. elegans glp-1(q1036) III. Show Description
Maintain at 15C. Germline tumor formation at 25C. A mix of fertile wild-type and proximal tumorous animals at 20C. glp-1(ar202) V5 CRISPR/Cas9 gene editing was used to insert a 3xV5 tag into C-terminus of GLP-1 between amino acids K(1209) and S(1210) using the same reagents as described for tagging wild-type GLP-1 (Sorensen et al., 2020). GLP-1 ar202V5 germlines express GLP-1 in membranes.
JK6059 C. elegans glp-1(q1035[*q1000]) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. CRISPR-engineered RAM mutations in endogenous glp-1 locus with C-terminal 4xV5 tag. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1035 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived by modification of parental strain JK5933 glp-1(q1000).
JK6063 C. elegans puf-8(q1048[3xV5::puf-8]) II. Show Description
3xV5 tag inserted into endogenous puf-8 locus via CRISPR/Cas9 engineering. Reference: Ferdous AS, et al. Development. 2023 May 1;150(9):dev201705. PMID: 37070766.
JK6080 C. elegans puf-3(q1058[3xV5::puf-3]) IV. Show Description
3x V5 epitope tags inserted into endogenous puf-3 locus. Expresses functional 3x V5-tagged PUF-3. Reference: Haupt KA, Genetics. 2020 Jan;214(1):147-161. PMID: 31740451
JK6099 C. elegans lag-2(q1049[lag-2::3xV5]) V. Show Description
CRISPR/Cas9 gene editing was used to insert a 3xV5 tag at the C-terminus of the endogenous lag-2 locus immediately upstream of stop codon. Animals are fertile and express LAG-2 V5 in adult DTCs.
JK6111 C. elegans sygl-1(q1054[*q943]) I. Show Description
C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory element LBS D (Yoo et al., 2004). Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6140 C. elegans nos-3(q902) II; qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6154 C. elegans lst-1(q1086 [*q1004]) I. Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif B disrupted (PIM B mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6188 C. elegans lst-1(q1115[*q1004]) I. Show Description
GGSGG linker::3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with a deletion removing a portion of the lst-1 locus. q1115 retains the N-terminal 1-210) region of LST-1. Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6203 C. elegans lst-1(q1125[*q1086]) I. Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motifs A&B disrupted (PIM AB mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6251 C. elegans apx-1(q1148[apx-1::3xV5]) V. Show Description
CRISPR/Cas9 gene editing was used to insert a 3xV5 tag inserted at the C-terminus of the endogenous apx-1 locus immediately upstream of STOP codon. Animals are fertile and express low levels of APX-1 V5 in adult DTCs.
JK6268 C. elegans qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3’utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem–loops in its 3?UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stem–loops in its 3?UTR; the mCherry reporter 3?UTR has three mutated boxB stem–loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6280 C. elegans puf-11(q1128[3xV5::puf-11]) IV. Show Description
3x V5 epitope tags inserted into endogenous puf-11 locus. Expresses functional 3x V5-tagged PUF-11. Reference: Haupt KA, Genetics. 2020 Jan;214(1):147-161. PMID: 31740451
JK6319 C. elegans lst-1(q1004[lst-1::3xV5]) sygl-1(q828) I. Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus.
JK6321 C. elegans puf-3(q966) puf-11(q971) IV/ nT1[qIs51] (IV;V). Show Description
Homozygous maternal effect lethal double mutant balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested GFP+ nT1[qIs51] aneuploids, and non-GFP puf-3(q966) puf-11(q971) homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain.
JK633 C. elegans unc-32(e189) glp-1(q46)/eT1 III; +/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, UncSteriles, and arrested eT1 aneuploid progeny (dead eggs). Maintain by picking wild-type and check for correct segregation of progeny to maintain. eT1 previously known as unc-36(e873). Do not distribute this strain; other labs should request it from the CGC.
JK6381 C. elegans lst-1(q1124[*q1004]). Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif A disrupted (PIM A mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6383 C. elegans mpk-1(q1147[V5::mpk-1B] q1183[mpk-1AB::2xOLLAS]) III. Show Description
Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
JK6389 C. elegans sygl-1(q1167[*q1135])) I. Show Description
C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elements LBS BCD (Yoo et al., 2004). Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6399 C. elegans lst-1(q1198[*q867]) I. Show Description
3xV5 epitope tag inserted into endogenous lst-1 locus with a 1 bp deletion in lst-1L-specific first exon tospecifically disrupt LST-1L isoform. Synthetically sterile in combination with sygl-1(lf). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6401 C. elegans lst-1(q869) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6403 C. elegans mpk-1(q1147[V5::mpk-1B] q1201[mpk-1B del] q1183[mpk-1AB::2xOLLAS])/qC1 [qIs56] III. Show Description
qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
JK6410 C. elegans fbf-2(q1078[*q945]) II. Show Description
q1078 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6412 C. elegans fbf-2(q1080[*q1011]) II. Show Description
q1080 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2 with a Y479A point mutation in the R7/R8 loop. Derived by modification of parental strain JK5984 fbf-2(q1011[*q945]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6432 C. elegans mpk-1(q1190)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Heterozygous animals Roll and have GFP(+) distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes which are sterile and vulvaless. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. q1190 is a deletion in mpk-1 that removes 2221bp between axons 2-7 (based on mpk-1b annotation). Sequence is shared between mpk-1a and mpk-1b. The deletion is in frame and leaves 27bp of coding sequence.Reference: Robinson-Thiewes S, et al. Cell Rep. 2021 May 25;35(8):109162. doi: 10.1016/j.celrep.2021.109162.
JK6468 C. elegans gld-3(q1215[*q1065]) II. Show Description
1xV5 tag inserted into endogenous gld-3 locus containing K864A & L867A engineered mutations, specifically tagging GLD-3L isoform. GLD-3L::1xV5 (K864A, L867A) animals are 30% Fog. Derived by CRISPR-engineered mutation of parental strain JK6091.
JK6509 C. elegans fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes. fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2]) homozygotes are partially sterile, ~50% make excess sperm and delay oogenesis resulting in delayed egg laying when compared to wild-type animals. Pick WT dim GFP and check for correct segregation of progeny to maintain. q1227 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5810.
JK6510 C. elegans fbf-1(q1228) fbf-2(q1011[*q945])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2 derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. q1228 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5984.
JK6516 C. elegans lst-1(q869) sygl-1(q1054) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1054 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6526 C. elegans let-711(q1238[let-711::3xV5]) III. Show Description
GSS linker and 3xV5 tag inserted at C-teminus of endogenous let-711 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6531 C. elegans gld-1(q1234) I. Show Description
CRIPSR-engineered modification of gld-1 FBEa* in gld-1 3'UTR.  Homozygotes are fertile with a slight increase in distal GLD-1 protein levels. Reference: Qiu et al., In preparation.
JK6540 C. elegans gld-1(q1242) I. Show Description
q1242 is an engineered TGT to ACA substitution in FBEa1 of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6541 C. elegans gld-1(q1243) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. CRIPSR-engineered modification of gld-1 FBEa and FBEa* in gld-1 3'UTR.  Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1243 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Increase in distal GLD-1 protein levels and decrease in proximal GLD-1 protein levels. Qiu et al., in preparation.
JK6547 C. elegans fbf-1(q1250) fbf-2(q738)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1250 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK3101.
JK6548 C. elegans fbf-1(q1251) fbf-2(q738)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1251 is an engineered H324A point mutation in FBF-1 derived by modification of parental strain JK3101.
JK6550 C. elegans fbf-2(q1264[*q1011])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H326A, Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6563 C. elegans daz-1(q1254[1xV5::daz-1]) II. Show Description
1xV5 tag inserted at N-teminus of endogenous daz-1 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6568 C. elegans gld-1(q1257) I. Show Description
q1257 is an engineered TGT to ACA substitution in FBEb of the endogenous gld-1 locus. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6578 C. elegans fbf-1(ok91) fbf-2(q1261[*q973])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK659 C. elegans mog-3(q74)/unc-93(e1500) dpy-17(e164) III. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, sterile Mog, and Unc Dpy. Pick wild-type and check for proper segregation of progeny. Do not distribute this strain; other labs should request it from the CGC.
JK6593 C. elegans fbf-2(q1262[*q945]) II. Show Description
3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A) substitutions.
JK6594 C. elegans ife-3(q1259[1xV5::ife-3]) V. Show Description
1xV5 tag inserted at N-teminus of endogenous ife-3 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6596 C. elegans fbf-1(ok91) fbf-2(q1272[*q1023])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6600 C. elegans lst-1(q869) sygl-1(q1167) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elementa LBS BCD (Yoo et al., 2004). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1167 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6602 C. elegans gld-1(q1271[*q1242]) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Engineered TGT to ACA substitutions in FBEa1 and FBEb of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP q1271 homozygotes (sterile Mog). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by modification of gld-1(q1242) homozygotes from parental strain JK6540. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6607 C. elegans fbf-1(ok91) fbf-2(q1263[*q973])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479F substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6658 C. elegans fbf-1(ok91) fbf-2(q1285[*q1261])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (N415A Y416A Q419A S453A H454A E457A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6673 C. elegans fzr-1(q1290[3xV5::fzr-1]) II. Show Description
Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp.
JK6678 C. elegans fbf-1(ok91) fbf-2(q1291[*q973])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479E substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.