| CFJ94 |
C. elegans |
unc-119(ed3) III; kstSi37 IV. Show Description
kstSi37 [Cbr-unc-119(kst13)] IV. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
|
|
| CG1428 |
C. elegans |
tmc-1(rg1003) X. Show Description
rg1003 promotes development and male mating behavior on a chemically defined C. elegans maintenance medium (CeMM). Reference: Zhang L, et al. Nature Communications (2015) In press.
|
|
| CGC1 |
C. elegans |
C. elegans wild isolate. Show Description
CGC1 (formerly known as PD1074) is intended to be used as a wild-type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). CGC1 is a defined and recently cloned population of animals derived from the original "Bristol" variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner's original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. CGC1 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. We note that CGC1 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in CGC1. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| CGC105 |
C. elegans |
hIn1 [umnIs78] I. Show Description
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::mKate2 transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.
|
|
| CGC11 |
C. elegans |
unc-5(e53)/nT1 [umnIs1] IV; dpy-11(e224)/nT1 V. Show Description
umnIs1 [eft-3p::GFP + HygroR, V:~2821000] V. umnIs1 GFP is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking GFP+ WT. Derived by insertion of GFP transgene into parental strain MT1000 using MosSCI.
|
|
| CGC12 |
C. elegans |
umnIs2 V. Show Description
umnIs2 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] V. Derived by insertion of tdTomato transgene into parental strain N2 using CRISPR/Cas9.
|
|
| CGC128 |
C. elegans |
+/hT2 [umnIs15] I; dcr-1(pk1351)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
|
|
| CGC13 |
C. elegans |
unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. Show Description
umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC138 |
C. elegans |
unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs79] V. Show Description
umnIs79 [myo-2p::GFP + NeoR, I: 6284001] I. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, arrested hT1 homozygotes (GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| CGC139 |
C. elegans |
unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs80] V. Show Description
umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| CGC140 |
C. elegans |
goa-1(n499)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
This strain is difficult and time consuming to maintain. Gives relatively few heterozygotes. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are paralyzed Unc and Egl with relatively dim pharyngeal GFP (Venus) expression. Heterozygotes segregate heterozygous non-Dpy GFP+ paralyzed Unc and Egl, non-GFP embryonic lethal (homozygous n499), and Dpy with brighter GFP+ (tmC20 homozygous). Remove Dpy from plate to prevent them from taking over. Heterozygotes tend to stack up in parallel clumps. Populations can be enriched by transferring these clumps to new plates and allowing Dpy (tmC20 homozygotes) to crawl out into bacterial lawn, and then picking away Dpy or transferring the clump of Hets to another plate. Derived by balancing n499 from parental strain MT1102 over tmC20 from FX30179.
|
|
| CGC15 |
C. elegans |
umnIs4 III. Show Description
umnIs4 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] III. Derived by insertion of tdTomato transgene into parental strain N2 using CRISPR/Cas9.
|
|
| CGC16 |
C. elegans |
hT2 [umnIs5] I; hT2 [bli-4(e937)] III. Show Description
umnIs5 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] I. Homozygous-viable translocation marked with bli-4 and tdTomato. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Derived by insertion of tdTomato transgene into parental strain KR1234 using CRISPR/Cas9.
|
|
| CGC17 |
C. elegans |
unc-4(e120)/mT1 [umnIs6] II; dpy-17(e164)/mT1 [dpy-10(e128)] III. Show Description
umnIs6 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] II. Heterozygotes are WT with dim red fluorescence, and segregate WT with dim red fluorescence, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes with more intense red fluorescence), and DpyUnc with no red fluorescence. Pick WT with dim red fluorescence and check for correct segregation of progeny to maintain.
|
|
| CGC177 |
C. elegans |
lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
|
|
| CGC18 |
C. elegans |
umnIs7 III. Show Description
umnIs7 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
|
|
| CGC19 |
C. elegans |
eT1 III; eT1 [umnIs8] V. Show Description
umnIs8 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
|
|
| CGC194 |
C. elegans |
dpy-26(n199)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Lethal/sterile dpy-26 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus n199 homozygotes (variable morphology). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Derived by crossing parental strains FX30140 with CB5101 (males).
|
|
| CGC2 |
C. briggsae |
C. briggsae wild isolate. Show Description
C. briggsae reference strain formerly known as PB420. Derived from C. briggsae Gujarat, the strain that later was named G16 and then AF16. PB420 was frozen (as C. briggsae Gujarat) 22 March 1991, thawed 15 June 2020 and sent to the CGC 1 July 2020. It may be considered ancestral to AF16 and was renamed to distinguish it from AF16 strains that have been maintained in laboratory cultures. Reference: Fodor A, et al. Nematologica 1983 92: 203-217. doi:10/1163.187529283X00456. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| CGC20 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs9] V. Show Description
umnIs9 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
|
|
| CGC22 |
C. elegans |
umnIs11 V. Show Description
umnIs11 [myo-2p::GFP + NeoR, V:1005689 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
|
|
| CGC23 |
C. elegans |
dpy-18(e364)/eT1 [umnIs12] III; unc-46(e177)/eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
|
|
| CGC24 |
C. elegans |
umnIs13 X. Show Description
umnIs13 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] X. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
|
|
| CGC25 |
C. elegans |
hT2 [umnIs14] I; hT2 [bli-4(e937)] III. Show Description
umnIs14 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] I. Homozygous viable. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
|
|
| CGC26 |
C. elegans |
dpy-5(e61)/hT2 [umnIs15] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
|
|
| CGC27 |
C. elegans |
umnIs16 X. Show Description
umnIs16 [myo-2p::GFP + NeoR, X:15420938 (intergenic)] X. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
|
|
| CGC28 |
C. elegans |
+/szT1 [lon-2(e678) umnIs17] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs17 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
|
|
| CGC29 |
C. elegans |
unc-13(e51)/hT1 [umnIs18] I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
umnIs18 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Dpy Unc, arrested hT1 homozygotes(GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| CGC3 |
C. tropicalis |
C. tropicalis wild isolate. Show Description
C. tropicalis reference strain formerly known as NIC58. Culture at 20°C or above. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| CGC30 |
C. elegans |
unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs19] (IV;V;f). Show Description
umnIs19 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type GFP+; animals that have lost the Dup are Dpy Unc GFP-. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.
|
|
| CGC31 |
C. elegans |
umnIs20 III. Show Description
umnIs20 [myo-2p::GFP + NeoR, III:518034 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
|
|
| CGC32 |
C. elegans |
sC1(s2023) [dpy-1(s2170) umnIs21] III. Show Description
umnIs21 [myo-2p::GFP + NeoR, III: 518034 (intergenic)]. Dpy GFP+. Derived by insertion of myo-2p::GFP transgene into sC1 balancer in parental strain BC4279 using CRISPR/Cas9.
|
|
| CGC33 |
C. elegans |
unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. Show Description
umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC34 |
C. elegans |
eT1 [umnIs12] III; eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
|
|
| CGC35 |
C. elegans |
+/szT1 [lon-2(e678) umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
|
|
| CGC36 |
C. elegans |
mnDp1 [umnIs25] (X;V)/+ V; unc-3(e151) X. Show Description
umnIs25 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)]. Pick wild-type GFP+ to maintain. Segregates lethals: homozygous Dp/Dp are lethal. Derived by insertion of myo-2p::GFP transgene into mnDp1 duplication in parental strain SP219 using CRISPR/Cas9.
|
|
| CGC37 |
C. elegans |
unc-3(e151) X; mnDp3 [umnIs26] (X;f). Show Description
umnIs26 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)]. Pick wild-type GFP+ to maintain. Segregates wild-type GFP+ and Unc GFP-. Derived by insertion of myo-2p::GFP transgene into mnDp3 duplication in parental strain SP123 using CRISPR/Cas9.
|
|
| CGC38 |
C. elegans |
umnIs27 III. Show Description
umnIs27 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
|
|
| CGC39 |
C. elegans |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. Show Description
umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC40 |
C. elegans |
+/szT1 [lon-2(e678) umnIs29] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs29 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-GFP, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
|
|
| CGC41 |
C. elegans |
+/szT1 [lon-2(e678) umnIs30 umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs30 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Carries szT1 balancer with mKate2 tag on left arm and GFP tag on right arm. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by insertion of myo-2p::mKate transgene into szT1 balancer in parental strain CGC35 using CRISPR/Cas9.
|
|
| CGC42 |
C. elegans |
mnDp10 [umnIs31] (X;I); unc-3(e151) X. Show Description
umnIs31 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Segregates mostly wild-type GFP+ and occasional Unc GFP-. Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnDp10 duplication in parental strain SP117 using CRISPR/Cas9.
|
|
| CGC43 |
C. elegans |
unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs32] II. Show Description
umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Hets are WT GFP+ and segregate WT GFP+, Unc-4 (GFP-) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnC1 balancer in parental strain SP127 using CRISPR/Cas9.
|
|
| CGC44 |
C. elegans |
unc-4(e120)/mIn1 [dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-4 non-GFP, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.
|
|
| CGC45 |
C. elegans |
unc-4(e120)/mT1 [umnIs34] II; mT1 [dpy-10(e128)]/dpy-17(e164) III. Show Description
umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
|
|
| CGC46 |
C. elegans |
+/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs35] X. Show Description
umnIs35 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
|
|
| CGC47 |
C. elegans |
hT2 I; hT2 [bli-4(e937) umnIs36] III. Show Description
umnIs36 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Homozygous-viable translocation marked with bli-4 and mKate2. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
|
|
| CGC48 |
C. elegans |
unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Hets are WT mKate2+ and segregate WT mKate2+, Unc-4 (no red fluorescence) and paralysed DpyUnc mKate2+ (mnC1). Maintain by picking WT mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain SP127 using CRISPR/Cas9.
|
|
| CGC49 |
C. elegans |
hT2 I; hT2 [bli-4(e937) umnIs38] III. Show Description
umnIs38 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Homozygous-viable translocation marked with bli-4 and GFP. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
|
|
| CGC50 |
C. elegans |
+/szT1 [lon-2(e678) umnIs39] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs40] X. Show Description
umnIs39 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs40 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs, and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by simultaneous insertion of independent myo-2p::mKate2 and myo-2p::GFP transgenes into each portion of the szT1 balancer in parental strain AF1 using CRISPR/Cas9.
|
|