Search Strains

More Fields
Strain Species Genotype Add
CE1494 C. elegans +/hT2 [dpy-18(h662)] I; pen-2(ep220)/hT2 [bli-4(e937)] III. Show Description
Heterozgyotes are WT and segregate WT, Dpys, and Ste or Mel. Pick wild-type individuals and check for correct segregation of progeny to maintain. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli.This strain cannot be distributed to commercial organizations. ep220 is likely Mel. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CE1570 C. elegans vps-35(ep442) rol-1(e91) II. Show Description
Weak Egl. Rollers. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CE1857 C. elegans ect-2(e1778)/unc-4(e120) sqt-1(sc13) II. Show Description
Heterozygotes are WT and segregate WT, Roller Uncs, and ect-2 homozygotes (sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes). ect-2 pka let-21. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CE541 C. elegans sbp-1(ep79) III. Show Description
Slow growth, low fat stores. Viable at 15C, not at 25C. Slightly Dpy, reduced brood size, low penetrance. Maintain under normal conditions. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Liang et al., (2010) PlosOne 5:3 e9869.
CE548 C. elegans sbp-1(ep79) III; epEx141. Show Description
epEx141 [sbp-1::GFP::SBP-1 + rol-6(su1006)]. ep79 is a strong allele of sbp-1 (ts lethal). sbp-1 aka pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CE778 C. elegans unc-29(e1072) aph-1(ep140)/fog-3(q443) I. Show Description
This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CE833 C. elegans sbp-1(ep176) III. Show Description
Weak sbp-1 allele. sbp-1 aka pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. NOTE: This strain carries an unknown GFP marker.
CER123 C. elegans ham-3(he159) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). Show Description
Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and ham-3(he159) homozygotes, which are Sma, Egl, Adl, Pvl. Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. he159 allele was isolated by John Satterlee from a deletion library at Sander van den Heuvel's lab. Reference: Ertl I, et al. Genetics. 2016 Mar;202(3):961-75.
CER4 C. elegans rsr-2(tm2625)/mIn1 [dpy-10(e128) mIs14] II. Show Description
mIs14 [myo-2::GFP]. Heterozygotes are WT and GFP+ with signal in the pharynx. Heterozygote animals segregate heterozygotes (WT GFP+), mIn1 homozygotes (Dpy and brighter GFP+), and rsr-2(tm2625) homozygotes (Lva non-GFP). Pick WT GFP+ animals and check for proper segregation of progeny to maintain. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543.
CER444 C. elegans sftb-1(cer114[mCherry::sftb-1]) III. Show Description
Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CER522 C. elegans ubh-4(cer140) rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
CER529 C. elegans sftb-1(cer144) III. Show Description
Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CER588 C. elegans cat-2(cer181[cat-2p::GFP::H2B 1-3]) II. Show Description
Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
CER660 C. elegans cer227[mex-5p::SpG(smu-2 introns) + unc-119(+)] II; unc-119(ed3) III. Show Description
Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4.
CEW1 Oscheius tipulae Oscheius tipulae. Show Description
Isolated in 1991 by Carlos E. Winter in soil samples taken at the University of Sao Paulo in Brazil. Hermaphrodite strain. Adults are smaller than C. elegans. The life cycle is a little longer than C. elegans at 22C. Each lays about 300 eggs in the three days following the moult from L4 to adult. Eggs are laid just after being fertilized resulting sometimes in plates with many eggs (much more than C. elegans). See Comp. Biochem. Physiol 103B: 189, 1992. See Nematology 2(1): 89-98, 2000. Can be grown and maintained on NGM. L1s easily frozen and stored in liquid nitrogen. This strain is deposited in Paul Sternberg's collection under the name PS1022. The species has not yet been determined; Lynn Carta will publish a paper proposing Oscheius brevesophaga. DO NOT use this name before the paper is published. Contact Carles E. Winter or Lynn Carta before publishing anything official about this strain. See also WBPaper00004471 and WBPaper00004485. AKA Oscheius sp. 1.
CF1135 C. elegans egl-20(n585) IV; muEx68. Show Description
muEx68 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CF1170 C. elegans egl-20(n585) IV; muEx79. Show Description
muEx79 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CF12 C. elegans rol-6(e187) II; lin-22(n372) IV; him-5(e1490) V. Show Description
Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5.
CF1380 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1553 C. elegans muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Many animals roll weakly or not at all, but still express GFP. Grows at all temperatures.
CF1814 C. elegans rrf-3(pk1426) II; daf-2(e1370) III. Show Description
Daf-c at 25.5C; grow at 20C or less. Long lived.
CF1880 C. elegans daf-16(mu86) I; glp-1(e2141) III. Show Description
Sterile at 25C; grow at 20C or less. glp-1(e2141) longevity suppressed by daf-16(mu86).
CF1935 C. elegans daf-16(mu86) I; glp-1(e2141) III; muIs109. Show Description
muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less.
CF1980 C. elegans rrf-3(pk1426) II; daf-2(e1368) III. Show Description
Daf-c at 25.5C; grow at 20C or less. Long lived.
CF2037 C. elegans muEx311. Show Description
muEx311 [pep-2p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. pep-2 is an other name for pept-1. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2060 C. elegans daf-16(mu86) I; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
CF2061 C. elegans daf-16(mu86) I; glp-1(e2141) III; muEx158. Show Description
muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.
CF2065 C. elegans kri-1(ok1251) I; glp-1(e2141) III. Show Description
Temperature-sensitive. Sterile at 25C. [NOTE: can be grown at 20C, but 15C might be better for long-term propagation.] kri-1(ok1251) suppresses the longevity of glp-1(e2141) mutants.
CF2135 C. elegans daf-16(mu86) kri-1(ok1251) I; glp-1(e2141) III; muIs109. Show Description
muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less.
CF2247 C. elegans daf-16(mu86) I; glp-1(e2141) III; muEx248. Show Description
muEx248 [daf-16::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain.
CF2248 C. elegans daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx158. Show Description
muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.
CF2263 C. elegans daf-16(mu86) I; glp-1(e2141) III; daf-9(rh50) X; muEx158. Show Description
muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.
CF2265 C. elegans daf-16(mu86) kri-1(ok1251) I; glp-1(e2141) III; muEx158. Show Description
muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.
CF2278 C. elegans daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx248. Show Description
muEx248 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain.
CF2288 C. elegans daf-16(mu86) I; glp-1(e2141) III; daf-9(rh50) X; muEx248. Show Description
muEx248 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain.
CF2805 C. elegans dop-2(vs105) V; dop-4(ok1321) dop-1(vs100) dop-3(vs106) X Show Description
Quadruple mutant removing four different dopamine receptor genes.
CF367 C. elegans mig-14(mu71) II. Show Description
QL descendants anterior, QR descendants slightly posterior to WT. HSN posterior (50%), BDU posterior (50%), DTCs make extra turns. Mild Egl. Male Mating: ME2. mig-14, mom-3, pvl-2, and let-553 are the same gene.
CF579 C. elegans dpy-20(e1282) IV; him-5(e1490) V; muIs27. Show Description
muIs27 [mig-2::GFP + dpy-20(+)]. Him. non-Dpy. GFP is membrane enriched and expressed in many cells throughout development (see reference for details). Not known in which LG muIs27 is integrated.
CF65 C. elegans mab-5(e2088) III; lin-22(n372) IV; him-5(e1490) V. Show Description
mab-5 mutation affects ectodermal and mesodermal lineages. lin-22 and him-5 mutations affect neuroblast formation from the epidermal precursor cell V5.
CF816 C. elegans him-5(e14??) V; ref-2(mu218) X. Show Description
In males, P7.p and P8.p fail to fuse with hyp7 at the end of L1. Dominant. him-5 allele is either e1467 or e1490.
CF978 C. elegans unc-24(e138) IV; bar-1(mu349) X. Show Description
Unc. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C.
CF980 C. elegans egl-20(n585) IV; bar-1(mu349) X. Show Description
Egl. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C.
CFJ108 C. elegans kstSi60 II; unc-119(ed3) III. Show Description
kstSi60 [LoxP + Cbr-unc-119(+) + LoxP + mlc-2p::GFP(kst32)] II. N2-like, no MLC-2::GFP fluorescence. mlc-2p::GFP(kst32) is a partial, non-functional GFP reporter used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.
CFJ111 C. elegans kstSi61 II; unc-119(ed3) III. Show Description
kstSi61 [LoxP + Cbr-unc-119(+) + LoxP + hygroR(kst31)] II. N2-like, no hygromycin resistance (HygroR). hygroR(kst31) is a partial, non-functional hygromycin-resistance construct used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.
CFJ184 C. elegans kstSi84 I; unc-119(ed3) III. Show Description
kstSi84 [LoxP + Cbr-unc-119(+) + LoxP + mlc-2p::GFP(kst32)] I. N2-like, no MLC-2::GFP fluorescence. mlc-2p::GFP(kst32) is a partial, non-functional GFP reporter used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.
CFJ191 C. elegans kstSi32 I; unc-119(ed3) III; kstEx45. Show Description
kstSi32 [Cbr-unc-119(kst13)] I. kstEx45 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
CFJ192 C. elegans unc-119(ed3) III; kstSi37 IV; kstEx46. Show Description
kstSi37 [Cbr-unc-119(kst13)] IV. kstEx46 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
CFJ302 C. elegans unc-119(kst33) III. Show Description
Maintain at 15C. Temperature-sensitive unc-119 allele. Wild-type at 15C, intermediate Unc and Egl at 20C, and fully penetrant Unc and Egl at 25C. For use in transgenesis, maintain the strain at lower temperatures for increased brood size and easier injection, then transfer animals to 25C to select for transgenic animals based on Unc rescue. Molecular characterization shows a complex allele with a 210 bp duplication from a nearby exon-intron junction, which introduces 12 amino acids and a putative splice donor at a consensus splice acceptor site. The phenotype is most likely caused by temperature-sensitive splicing defects based on RT-PCR. Reference: Aljohani M, et al. Arrayed oligo libraries: genome-wide DNA- and RNP-based platforms for templated and non-templated CRISPR-Cas9 editing in C. elegans. (Submitted)
CFJ42 C. elegans kstSi42 II; unc-119(ed3) III. Show Description
kstSi42 [Cbr-unc-119(kst13)] II. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
CFJ77 C. elegans kstSi32 I; unc-119(ed3) III. Show Description
kstSi32 [Cbr-unc-119(kst13)] I. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.