Search Strains

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

kyIR9 [X: ~4745910 - ~4927296, N2>CB4856] X. LG X contains N2 from ~4745910 - ~4927296; the rest is from CB4856. QX9 was crossed to CB4856; a recombinant F2 with N2 npr-1 and CB4856 tyra-3 was isolated. Its progeny was back-crossed to CB4856 8 times, picking npr-1 hets each round prior to homozygosing.

kyIs722 [str-2p::GCaMP5(D380Y) + elt-2::mCherry]. GCaMP5a expression driven by str-2 promoter, providing a very bright integrated calcium indicator useful for imaging of AWC(on).

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs30 [glr-1::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-6 is temperature sensitive. Posterior axon from amphid neuron. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-9 is temperature senstive. Amphid axon guidance defects (termination, guidance). This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Defective in the axon guidance of neurons. Maintain at 20C or 25C.

sax-3 mutants have an anteriorly-displaced nerve ring, defects in axon guidance to the ventral midline, and extra axon crossing at the ventral midline. There are also defects in CAN and HSN cell migration, a notched head and an Egl phenotype. This allele is 80% lethal in embryonic stages. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs37 [odr-10::GFP + lin-15(+)] II. No lin-15 mutation in background. Translational fusion; first few amino acids of odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs53[odr-10::GFP]. Full length odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Temperature sensitive. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs39 [sra-6::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Amphid axon guidence defect. HSN axon guidence defect. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs105 [str-3p::snb-1::GFP + lin-15(+)]. Also known as str-3::VAMP::GFP or ASI::VAMP::GFP or M7::VAMP::GFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs128 [str-3::GFP + lin-15(+)]. kyIs128 encodes a translational fusion contaning 4aa coding sequence (M7.13::GFP). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs140 [str-2::GFP + lin-15(+)] I. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs156 [str-1p::odr-10(cDNA)::GFP]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Double mutants with ocr-2 have reduced AWA gene expression. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Chemosensory, mechanosensory, and osmosensory defects. Null allele. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant.

ky51 animals are WT (or nearly WT) for locomotion, defecation rate, egg laying and fertility at 15C and 20C. Become Unc within 60 seconds when shifted to 25C. Recover when shifted back to 15C or 20C. dyn-1 encodes a dynamin GTPase. Received new stock from Cori Bargmann Jan 2005.

Viable. Can be scored only using special neuronal markers such as zdIs5 [mec-4p::GFP + lin-15(+)], which labels the touch cells and shows that they have aberrant anterior processes in the slt-1 mutant.

kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-36 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-26 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Originally had kyEx648 [unc-86 + syg-1::GFP] in this strain, but the CGC stock does not contain the array.

668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'.

kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Sqt phenotype. The daf-16(mg242) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg242 is a nonsense mutation Trp220Amb.

Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.

Sqt phenotype. The pdk-1(mg261) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg261 is an activating missense mutation Ala447Val.

Sqt phenotype. The akt-1(mg247) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg247 is an activating missense mutation Ala149Thr.

Heterozygotes are WT and segregate WT, DpyUncs and Sqt. age-1(mg109) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive). age-1(mg109) homozygous animals that are maternally rescued for dauer formation are long-lived.

bvIs5 [cyp-35B1p::GFP + gcy-7p::GFP]. Little or no GFP expression in adults. GFP expressed in intestine of dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.

rexIs1 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of Halo protein with TEV recognition site for the tobacco etch virus protease and human Keap1 protein (an established RES sensor). No phenotypic change upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.

frSi17 [mtl- 2p::rde-1 3'UTR] II. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. Derived by crossing parental strains IG1839 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. frSi17 inserted into ttTi5605 site.

neIs9 [myo-3p::HA::rde-1 + rol-6(su1006)] X. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. Rollers. RDE-1 activity is rescued in the body-wall muscle, making animals RNAi-deficient except for body-wall muscle cells. Derived by crossing parental strains WM118 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.

rexEx7 [gpa-4p::gfp::halo + mec-7p::mRFP]. Pick fluorescent worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Green fluorescence in two ASI neurons.

rexEx8 [sur-5p::GFP::halo + mec-7p::mRFP]. Pick fluorescent worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Green fluorescence in somatic cells.

rexEx10 [hsp-16p::his-6::Halo + mec-7p::mRFP]. Pick RFP+ to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces the expression of Halo protein.

dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.

rexIs2 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Array is prone to silencing; pick RFP animals to maintain array. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of mCherry with tom70 (outer mitochondrial membrane targeting sequence from yeast) and Halo protein. Global red fluorescence upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.

dvIs19 [gst-4p::GFP::NLS] III. rexEx12 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of mCherry::Halo protein. Oxidative stress induces expression of GFP.

dvIs19 [gst-4p::GFP::NLS] III. rexEx13 [hsp-16p::HA::wdr-23::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of HA::WDR23::Halo protein. Oxidative stress induces expression of GFP.

rexEx1 [myo-2p::GFP::Halo + mec-7p::mRFP]. Pick GFP+ to maintain. Mosaic expression of green fluorescence (GFP) in pharynx and red fluorescence (mRFP) in touch-receptor neurons.