Search Strains

Superficially wild-type. Reference: Simske J & Dong Y. (2017). International Worm Meeting. The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis. WBPaper00051789.

mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Variably Abnormal with body shape defects and bobbed tail at all stages. Reference: Vuong-Brender TTK, et al. PLoS One. 2018 Feb 21;13(2):e0193279.

Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen). Reference: Simske JS, et al. Nat Cell Biol. 2003 Jul;5(7):619-25.

Weak chemotaxis toward diacetyl. Possibly due to the weak chemotaxis toward diacetyl, qr1 were more preferentialy attracted by sodium acetate than WT in simultaneous two-spot presentation of sodium acetate and diacetyl. Mutagen used was Mos1 transposon, but it is not an insertion allele.

Weak chemotaxis toward low concentrations of sodium acetate. qr2 were more preferentialy attracted by diacetyl than WT in simultaneous two-spot presentation of sodium acetate and diacetyl. Mutagen used was Mos1 transposon, but it is not an insertion allele.

izEx5 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

zfIs42 [rig-3p::GCaMP3::SL2::mCherry + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.

Male-female strain. Maintain by mating. Isolated from garden soil in Buenos Aires, Argentina on 3/2/2012.

tm442 is a 411 bp deletion and 13 bp insertion. Outcrossed to mC6g males. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

tm1692 is a 656 bp deletion and 13 bp insertion. Outcrossed to mC6g males. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

~20% gonadogenesis defects, primarily one-armed gonads. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

Homozygous viable, non-Psa (Sawa), no gonadogenesis defects. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3395 homozygotes are maternal effect lethal (late embryo & larval lethal) and have progeny with gonadogenesis defects. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

rdIs2 [ehn-3a::GFP + rol-6(su1006)] V. Rollers. The ehn-3a::GFP reporter (pRA230) contains 3,003 bp upstream of the ehn-3a translational start and the first two exons of ehn-3a. GFP expression in Z1 and Z4 during embryogenesis and early larval development. Reference: Welchman DP, Mathies LD, Ahringer J. (2007) Dev Biol. 305(1): 347-57.

Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3309 homozygotes are maternal effect lethal (late embryo & larval lethal) and have gonadogenesis defects. Previously known as swsn-2.1(tm3309). Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

Heterozygotes are wild-type GFP+ that segregate wild-type GFP+ heterozygotes, GFP- tm4263 homozygotes (MEL), and Dpy GFP+ mIn1 homozygotes. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm4795 homozygotes. tm4795 homozygotes arrest as early larvae. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

rdEx1 [GFP::tra-1 + rol-6(su1006)]. Rollers. Array can cause sterility. Maintain by picking gravid Rollers. GFP::tra-1 fusion protein. Reference: Mathies LD, et al. Development. 2004 Sep;131(17):4333-43.

Slow growth. Abnormal tail.

Cephalobidae family. Cephalobus sp. Isolated by Susan Euling from soil near a roadway in Pontianak, Borneo, Indonesia in December 1994. Family and genus identification by Lynn Carta.

Male-female strain. The species was isolated in Sept 2003 by Robin Giblin Davis from an individual of the weevil Metamasius hemipterus. The beetle was collected in Fort Lauderdale, FL. It was established from a single female. Morphology is identical to RGD1 and PS1010 but mating tests have not been performed with this strain.

Heterozygotes are WT and segregate WT and sterile Dpys. Referenced in Li, W. et al. J Cell Bio 187(1):33-42 (2009).

snt-1(md290) is a 3264-bp deletion removing all coding sequence in exons 3-8. Breakpoints: ttatagatttcaattaaatagtaaacaaaa / / aatctctctttgttttcactcttccaacat. Reference: Nonet ML, et al. Cell. 1993 Jul 2;73(7):1291-305.

snt-1(md220) is a 9-bp deletion in exon 5 removing V312-L314. Breakpoints: ggtacgtcccaactgctggtaaattgacag / / tggaagcaaaaaatcttaagaaaatggacg. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

snt-1(md259) is a 2-bp deletion in exon 6A. Breakpoints: tttcattttctggggtaattttcagatcct / / tgtgaagattgtgttgatgcaaggtggaaa. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

Cosmid coordinates (with respect to T23G5): 24967-26802 (or 24965-26800, or 24966-26801, or 24968-26803, or 24969-26804 - note that each deletion endpoint lies within a TATA sequence so there is some ambiguity in the precise endpoints). Flanking sequences: CTATTCGGATATCTTGCCAATGCTA//TAGGAATTATTTTTGCGCTCTCAGG. Deletion size: 1836 bp.

Knock-out allele ok237 is a large (2229-bp) deletion. Coordinates: leftmost deleted base = 35441 of K02G10; rightmost deleted base = 296 of F55D10. ok237 eliminates almost all of K02G10.8 (dnj-14) and also the 5'-part of F55D10.3 (glit-1, encodes a homolog of gliotactin), as well as the presumed promoter regions between the 2 genes. In addition, F55D10.3 could be the first member of an operon, with F55D10.2 (aka rpl25.1, which encodes a ribosomal protein) as the second member of the operon. The deletion is likely to eliminate the expression of 2 or 3 genes, not just dnj-14.

Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72.

Nemadipine-A resistant.

Nemadipine-A resistant.

Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72.

pwIs23 [vit-2::GFP].

Large intestinal vacuoles.

Yolk endocytosis defective.

pwIs32 [vit-2::GFP]. Yolk endocytosis defective.

bIs1 [vit-2::GFP + rol-6(su1006)]. Rollers. Yolk endocytosis defective. Reference: Sato M, et al. EMBO J. 2008 Apr 23;27(8):1183-96.

stEx30 [myo-3p::GFP::myo-3 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. stEx30 rescues myo-3(st386); animals which have lost the array arrest as 2-fold dead embryos. See also WBPaper00005628.

WT strain. Segregates dead eggs.

WT strain. Segregates dead eggs.

Heterozygotes are slow moving and fertile. stDf4 homozygotes move well and are sterile. st22 homozygotes are small and very sick. Pick slow moving animals and avoid well moving fertile recombinants.

Heterozygotes are WT and segregate WT, Dpys and embryos which arrest at the 2-fold stage.

Heterozygotes are WT. Segregates WT, Sqt and Dead embryos (2-fold arrest). myo-3 Null. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs.

Heterozygotes are WT and segregate WT, Dpys and Pats. Maintain by picking WT and checking for correct segregation of progeny.

Heterozygotes are WT and segregate WT, DpySteriles and PATs. st564 is a recessive lethal which causes a "severe" PAT phenotype. Strain is well balanced.

GFP tag inserted into the endogenous tba-2 locus. GFP signals are detected at the epidermis, germline, intestine, muscle, and neurons. Reference: Honda Y, et al. J. Cell. Sci. 2017 May 1;130(9):1652-1661. PMID: 28302908.

GFP tag inserted into the endogenous tba-1 locus. GFP signals are detected at the epidermis, germline, intestine, muscle, and neurons. Reference: Honda Y, et al. J. Cell. Sci. 2017 May 1;130(9):1652-1661. PMID: 28302908.

GFP::TEV::3xFLAG tag inserted into the endogenous tba-2 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.

GFP::TEV::3xFLAG tag inserted into the endogenous tba-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.

GFP::TEV::3xFLAG tag inserted into the endogenous tbb-4 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.