Strain Information

Name RM1613   View On Wormbase
Species C. elegans
Genotypesnt-1(md290) II.
Descriptionsnt-1(md290) is a 3264-bp deletion removing all coding sequence in exons 3-8. Breakpoints: ttatagatttcaattaaatagtaaacaaaa / / aatctctctttgttttcactcttccaacat. Reference: Nonet ML, et al. Cell. 1993 Jul 2;73(7):1291-305.
MutagenNo mutagen
Outcrossedx7
Made byJim Rand
Laboratory RM
Sign in or register an account if you want to order this strain.