Weak chemotaxis toward diacetyl. Possibly due to the weak chemotaxis toward diacetyl, qr1 were more preferentialy attracted by sodium acetate than WT in simultaneous two-spot presentation of sodium acetate and diacetyl. Mutagen used was Mos1 transposon, but it is not an insertion allele.

paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056

vhIs24 [vha-6p::GFP::rab-5 Q78L + Cbr-unc-119(+)].  Large endosomes in the intestinal cells.

Large yolk platelets in oocytes. Premature yolk degradation in embryos. Large endosomes in coelomocytes and intestine. Reference: Chotard L, et al. Mol Biol Cell. 2010 Jul 1;21(13):2285-96.

Maintain at 15C.  Temperature-sensitive embryonic lethal with defects in embryonic cytokinesis.  Suppressor of the lin-2 Vul phenotype

Dpy, Emb, Lvl, Suppressor of the lin-2 Vul phenotype, large endosomes in coelomocytes

vhIs12 [vha-6p::GFP::tbc-2 + Cbr-unc-119(+)] II.  vhIs12 is inserted to the left of tbc-2(m2241) in LG II. GFP::TBC-2 rescues the large endosome phenotype in the intestine of tbc-2(tm2241) animals. Outside the intestine, tbc-2(tm2241) animals have large yolk platelets in the oocytes and early embryos that are not rescued.