Strain Information

Name RM2702   View On Wormbase
Species C. elegans
Genotypedat-1(ok157) III.
DescriptionCosmid coordinates (with respect to T23G5): 24967-26802 (or 24965-26800, or 24966-26801, or 24968-26803, or 24969-26804 - note that each deletion endpoint lies within a TATA sequence so there is some ambiguity in the precise endpoints). Flanking sequences: CTATTCGGATATCTTGCCAATGCTA//TAGGAATTATTTTTGCGCTCTCAGG. Deletion size: 1836 bp.
MutagenUV/TMP
Outcrossedx6
Made byB Barstead/G Mullen
Laboratory RM
Sign in or register an account if you want to order this strain.