Strain Information
Name | RM2702 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | dat-1(ok157) III. |
Description | Cosmid coordinates (with respect to T23G5): 24967-26802 (or 24965-26800, or 24966-26801, or 24968-26803, or 24969-26804 - note that each deletion endpoint lies within a TATA sequence so there is some ambiguity in the precise endpoints). Flanking sequences: CTATTCGGATATCTTGCCAATGCTA//TAGGAATTATTTTTGCGCTCTCAGG. Deletion size: 1836 bp. |
Mutagen | UV/TMP |
Outcrossed | x6 |
Made by | B Barstead/G Mullen |
Laboratory | RM |
Sign in
or
register an account if you want to order this strain.