Search Strains

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.

Fertile at all temperatures.

Dpy. Fertile at all temperatures.

Fertile at all temperatures.

Dpy. Fertile at all temperatures.

Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2.

Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk526 homozygotes (variable arrest, early larval). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47.

ncIs1 [eat-20::GFP + rol-6(su1006)]. Rollers.

ncIs2 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. No morphological or behavioral phenotypes.

ncEx2365 [del-1p::Arch::eGFP + (pCFJ90) myo-2p::mCherry]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

ncEx2371 [acr-5p::Arch::eGFP + (pCFJ90) myo-2p::mCherry]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

Ventral cord displacement and detachment. Muscle attachment defects. Some larval lethality.

Ventral cord displacement and detachment. Muscle attachment defects. Some larval lethality.

Ventral cord displacement and detachment. Muscle attachment defects. Some larval lethality.

ncEx3003 [hsp16-2p::Arch::eGFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

ncEx3026 [aex-3p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

ncEx3031 [myo-3p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

ncEx3034 [F25B3.3p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

ncEx3090 [tph-1p::Arch::eGFP + (pCFJ90) myo-2p::mCherry]. Pick GFP+mCherry+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

Various epidermal defects. In male tails, ray 1 is dislocated anteriorly.

ncIs3 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. No morphological or behavioral phenotypes.

Various epidermal defects. In male tails, ray 1 is dislocated anteriorly.

Starved appearance: shorter body length, pale intestine, reduced pharyngeal pumping, smaller brood size and extended egg-laing period.

Reduced brood size. Reduced phosphorylation level of eIF2alpa. Isolated as a suppressor of the ray1 phenotype of plx-1.

ncIs13 [ajm-1::GFP].

ncIs17 contains [hsp-16.2::eGFP + pBluscript]. Superficially wild-type.

ncEx9013 [lin-32p::FLAG::h4EBP1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to h4EBP1 cDNA and inserted into pPD49.26 containing lin-32p followed by the FLAG-coding sequence to generate in-32p::FLAG::h4EBP1. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.

Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.

Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.

Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.

Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.

Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.

Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.

jcEx44 [ajm-1::GFP + rol-6(su1006)]. Throws Rollers (weak -- some animals appear nearly wild-type) expressing ajm-1::GFP and dead eggs.

jcIs17 [hmp-1p::hmp-1::GFP + dlg-1p::dlg-1::DsRed + rol-6(su1006)]. Rollers. References: Zaidel-Bar R, et al. J Cell Biol. 2010 Nov 15;191(4):761-9. Raich WB, et al. Curr Biol. 1999 Oct 21;9(20):1139-46.

Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.

Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.

Superficially wild-type. Derived by outcrossing RB820 eight times to N2. Reference: Maia, A.F. et al. 2015 Sci Data 2:150020.

heIs63 [wrt-2p::GFP::PH + wrt-2p::GFP::H2B + lin-48p::mCherry] V. GFP expression in seam cells and mCherry expression in pharynx. Reference: Wildwater M, et al. Development. 2011 Oct;138(20):4375-85.

heEx526 [myo-2p::GFP]. Superficially wild-type. Pick GFP+ to maintain. Derived by crossing SV1005 and SV1069. Reference: Maia, A.F. et al. 2015 Sci Data 2:150020.

mjSi74 [mex-5p::wormCherry::prde-1::par-5] I. Integration into ttTi4348. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.

Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased.

Transposon silencing abnormal. Superficially WT. Deletion breakpoints: CGGTTCGTTTTCTTGAATCG//CCTTTAAGTTTTCATCTCAA.

21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT.

chEx1682 [pLH070(qua-1(full-length)::GFP + rol-6(su1006)]. Rollers. Maintain under normal conditions; pick rollers. Reference: Hao et al. (2006) Dev Dyn 235:1469-81.

Growth slightly retarded. Electropharyngeograms largely lack M3 spikes.

Growth slightly retarded. Electropharyngeograms largely lack M3 spikes. Temperature sensitive Muv.

WT strain. ch1 deletes only intron sequences.

Reference: Bailly AP, et al. PLoS Genet. 2010 Jul 15;6(7):e1001025. Agostinho A, et al. PLos Genetics 2013.