Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RM2754 C. elegans dnj-14(ok237) X. Show Description
Knock-out allele ok237 is a large (2229-bp) deletion. Coordinates: leftmost deleted base = 35441 of K02G10; rightmost deleted base = 296 of F55D10. ok237 eliminates almost all of K02G10.8 (dnj-14) and also the 5'-part of F55D10.3 (glit-1, encodes a homolog of gliotactin), as well as the presumed promoter regions between the 2 genes. In addition, F55D10.3 could be the first member of an operon, with F55D10.2 (aka rpl25.1, which encodes a ribosomal protein) as the second member of the operon. The deletion is likely to eliminate the expression of 2 or 3 genes, not just dnj-14.
VC3162 C. elegans +/szT1 [lon-2(e678)] I; dnj-14&glit-1(ok237)/szT1 X. Show Description
F55D10.3, K02G10.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok237 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTGTTCGGTAAGCATTGGG. External right primer: AAAGTGTGTTCCGTCCTTGG. Internal left primer: CTGCCGTGGAATCTACCTGT. Internal right primer: GCAGTCGAACAACCACTTCA. Internal WT amplicon: 3216 bp. Deletion size: 2229 bp. Deletion left flank: TTTTGAGAAGGCGGTGGAGGCATGGCAATC. Deletion right flank: TTCGCTAAAAAATTGAGCCAATTTATTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CX12724 C. elegans acc-4(ok2371) III. Show Description
Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
RB1831 C. elegans set-22(ok2370) V. Show Description
Y32F6A.1. Homozygous. Outer Left Sequence: CAATCAAAATGAGTTCGGCA. Outer Right Sequence: TCCTCAACTGATAGACGGGC. Inner Left Sequence: AAATTGGCAACAGACTCAAAAA. Inner Right Sequence: TCTCGATTGAAATTCCCGAG. Inner Primer PCR Length: 3158 bp. Deletion Size: 1483 bp. Deletion left flank: CAACAATGTCTCTTGAGAATTCAAAAATCT. Deletion right flank: AAGATATTTAAATACTTTTAAAACTTTTTA. Insertion Sequence: ATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1832 C. elegans acc-4(ok2371) III. Show Description
T27E9.9 Homozygous. Outer Left Sequence: cgtcctcgccattctcttag. Outer Right Sequence: tttcgccaaaattatctccg. Inner Left Sequence: atccgaggacacagatttgg. Inner Right Sequence: tggccttcgttgtcttcttt. Inner Primer PCR Length: 3018. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1833 C. elegans K10B3.5(ok2372) X. Show Description
K10B3.5 Homozygous. Outer Left Sequence: aaagccgttcatgtcaaacc. Outer Right Sequence: acgagagaagacatgggacg. Inner Left Sequence: gagtagtgtgagctgctgcg. Inner Right Sequence: ggtgttccttctcaaatggc. Inner Primer PCR Length: 3221. Deletion size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1834 C. elegans che-7(ok2373) V. Show Description
F26D11.10. Homozygous. Outer Left Sequence: AAAATTCGTCCGAGTCGTTG. Outer Right Sequence: GAGCAGTGGCTCTTTGCTCT. Inner Left Sequence: TGATTCTGGCCATCAGAATTT. Inner Right Sequence: GGGGCACAAAAATGAGAGAA. Inner Primer PCR Length: 3059 bp. Deletion Size: 1496 bp. Deletion left flank: TGCCCACGTACATTATTTTTGTCGCCTGAA. Deletion right flank: GCACTGCCATCATAATAAGAAACGATGATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1835 C. elegans F41D9.1(ok2374) X. Show Description
F41D9.1 Homozygous. Outer Left Sequence: tcgtgctccactctcatttg. Outer Right Sequence: gttgaaccgatcggaagaga. Inner Left Sequence: aagaaaggtgagcgctgtgt. Inner Right Sequence: gccttgtggcctaatggata. Inner Primer PCR Length: 3251. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1836 C. elegans W05B5.2(ok2375) I. Show Description
W05B5.2 Homozygous. Outer Left Sequence: acgttaagaaaccgcctttg. Outer Right Sequence: cggaatcgtcctgaaatgtt. Inner Left Sequence: aagtctccaccaatgcaaaa. Inner Right Sequence: ttctttcttttatttttcggtttca. Inner Primer PCR Length: 3143. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1837 C. elegans C54A12.2(ok2376) II. Show Description
C54A12.2. Homozygous. Outer Left Sequence: AGGCTACCGTGTCGGTATTG. Outer Right Sequence: TCAGTCGGCAACGTATGAAA. Inner Left Sequence: GAAAAATGTTGAGGCGGTGT. Inner Right Sequence: ATCTTTGGCATGTTTGGCTC. Inner Primer PCR Length: 2721 bp. Deletion Size: 1540 bp. Deletion left flank: TCCCACTTCCTTCTGCAATAACCTTAACAC. Deletion right flank: CAGAGAATGCAATTTGATAATGATGGTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1839 C. elegans C18H2.2(ok2379) III. Show Description
C18H2.2. Homozygous. Outer Left Sequence: AAGTTGGAACCTTGGAGCCT. Outer Right Sequence: ACAGCGTCGTTGAAAGATCA. Inner Left Sequence: AACTGCTCCCATGTGACCTAA. Inner Right Sequence: CACTTCTGAAAATTCCACCGA. Inner Primer PCR Length: 3037 bp. Deletion Size: 1531 bp. Deletion left flank: TATTTTTCGTGTAACAATCTATTTTTCGTGGAACAATCTATTTTTCGTGTAACAATCTA TTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATT TTTC. Deletion right flank: ATCATCTTTGGATGTGACCAGCGCTGAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2311 C. elegans inx-15(ok2377) bli-4(ok3478) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R12E2.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Deletion chromosome appears to carry a second-site mutation in bli-4. Heterozygotes are Bli with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2377 homozygotes (early larval arrest, Dpy). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick Bli GFP and check for correct segregation of progeny to maintain. External left primer: AACAAGCCACACCGATAAGG. External right primer: GCAGACAAAAGGACCTGCAT. Internal left primer: TCGATGTTCGGAATACGATG. Internal right primer: TTTTAGATTATTTCAAAAGCGCA. Internal WT amplicon: 3163 bp. Deletion size: 1297 bp. Deletion left flank: CGAAGCATGGAAGAAATGTTGGAAAGACGT. Deletion right flank: AAGTCATATATTGTTTGATATCAATTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2705 C. elegans zwl-1(ok2378) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y39G10AR.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2378 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGCGAAAACAAAACAATTT. External right primer: TGAGGAAATTTCGGCTCATT. Internal left primer: TTTCCCAGAAAATGCCACTC. Internal right primer: GCAACTCTGGCATGCTTTTT. Internal WT amplicon: 2881 bp. Deletion size: 2093 bp. Deletion left flank: CAGCGGTTGTGACAAAGAAAAGTGTGCGAA. Deletion right flank: TTGCAACGGAGAATCGACCGGCTCCTGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807