Search Strains

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h119 arrests as a sterile adult). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h104 arrests as a sterile adult). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h126 arrests as a sterile adult). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h1012 arrests as a late larva, and h106 arrests as an early larva; the double arrests as an early larva). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h112 arrests as a mid-stage larva). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h217 arrests as an early larva). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h225 arrests as an early larva). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h251 arrests as a mid-stage larva). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h259 arrests as a leaky sterile adult). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h262 arrests as an early to mid-stage larva). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs. h269 arrests as an early to mid-stage larva. Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h271 arrests as a sterile adult). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h313 arrests as a sterile adult). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs. h442 arrests as an early larva. Maintain by picking Unc-13 and checking for correct segregation of progeny.

kasEx80 [oig-1p::tagRFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to maintain array. RFP driven by minimal oig-1 promoter for expression in VD-type GABAergic motor neurons. This construct uses the minimal length of promoter containing overlapping LIN-39 and UNC-30 ChIp-seq peaks (deletion of the single LIN-39 binding site within it compromised GABAergic motor neuron expression). Whereas other available oig-1 constructs are expressed ectopically in cholinergic motor neurons in unc-3 mutants, expression of this construct remains exclusively in GABAergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasIs7 [snb-1p::C9 ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: https://pubmed.ncbi.nlm.nih.gov/34654821/

kasEx73 [unc-3p::dsUnc-3(RNAi) + myo-2p::GFP]. Pick GFP+ to maintain array. Array carries a construct with the unc-3 promoter driving transcription of a hairpin targeting unc-3 for RNAi depletion in cholinergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx147 [oig-1p(1.6kb)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 1.6kb cis-regulatory region (-2.6-1.0kb) upstream of oig-1 was fused to GFP with the unc-54 3'UTR. oig-1 uses mulitple cis-regulatory regions to achieve different expression patterns in motor neurons; this construct drives expression specifically in cholinergic motor neurons. Construct was injected into N2 worms. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx149 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 200bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is been abolished; expression was observed specifically in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx157 [unc-11p::C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

mNeonGreen::3xFLAG::AID* was inserted at the C-terminus of the endogenous lin-39 locus by CRISPR. Endogenous lin-39 expression marked by mNG. LIN-39 protein can be degraded by Auxin application with expression of TIR-1 protein. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasIs10 [snb-1p::UAG ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

AID*::TEV::3xFLAG tag inserted at the C-terminus of the endogenous nhr-25 locus by CRISPR. Allele obtained by pha-1 co-conversion, following Ward 2015 method. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain allows somatic depletion of NHR-25::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY84 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.

AID*::TEV::3xFLAG tag inserted at the C-terminus of the endogenous nhr-23 locus by CRISPR. Allele obtained by pha-1 co-conversion, following Ward 2015 method. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain for somatic depletion of NHR-23::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY87 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.

Homozygous viable. km11 is a deletion/duplication of klc-2; see Sakamoto, et al. PMID: 15563606 for detailed description. Reference: Sakamoto R, et al. Mol Biol Cell. 2005 Feb;16(2):483-96. PMID: 15563606

Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi12 [cdk-9(D235N)::mCherry + unc-119(+)] II. Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi17 [cdk-12::GFP::mex-5 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi20 [cdk-9::mCherry::mex-5 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi21 [cdk-9::GFP::pal-1 3'UTR + unc-119(+)] II. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi21 [cdk-9::mCherry::pal-1 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi21 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).

rnyEx109 [nhx-2p::D3cpv + pha-1(+)]. Maintain at 20-25C to select for array. KWN190 strain expresses the FRET-based calcium indicator protein D3cpv throughout the cytoplasm of intestinal cells. Dual emission ratio imaging (ex. 435, em. 480/535-nm) can be used to measure intestinal calcium and, although the FRET pair is CFP/YFP, intestinal D3cpv fluorescence is observable under standard GFP filter sets. The D3cpv biosensor has the advantages of being relatively pH-insensitive and not interfering with endogenous calmodulin signaling. References: Am J Physiol Cell Physiol. 301:C1389-1403. Am J Physiol Cell Physiol. 297:C1071-81. FASEB J. 27:760-768. PLoS Biol. 11: e1001613.

rnyEx6 [nhx-2p::pHluorin + pha-1(+)]. Maintain at 20-25C to select for array. KWN26 strain expresses the pH-sensitive GFP variant pHluorin throughout the cytoplasm of intestinal cells. Dual excitation ratio imaging (ex. 410/470, em. 435-nm) can be used to measure intestinal pH and intestinal pHluorin fluorescence is observable under standard GFP filter sets. References: J Biol Chem 278:44657-44666. Curr Biol. 18: 297-302. Am J Physiol Cell Physiol. 297:C1071-81. Am J Physiol Cell Physiol.302 C1045-1054.

At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.

bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Temperature sensitive induction of germ cell apoptosis at 25 C. Large number of germ cells are decorated by CED-1::GFP within 48 h. Activates CED-3-mediated cleavage of IFG-1, visualized by western blot (Contreras, V., et al, 2011).

No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).

C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).

bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Temperature-sensitive germ cell apoptosis leading to infertility at 25 C. Apoptosing germ cells are decorated by CED-1::GFP in the gonad. Loss of p170 form of IFG-1 (but not p130 IFG-1) confirmed by Western blot. Escaping eggs are fertilized and embryonic lethal. Mos-1 transposon insertion previously described as ifg-1::mos-1(cxP9279) II; confirmed by triple primer PCR with 5’-ACCAAACTGGGCAAACAAAG-3’, 5’-GCTCAATTCGCGCCAAACTATG-3’, and 5’-CTTCCTGAAATTTGGTTTAACAGT-3’. Homozygous ifg-1::mos yields only 444 bp product. Outcrossed heterozygotes yield both 353 bp (wild type ifg-1) and 444 bp products.

Superficially WT. by108 completely suppresses the Egl defect of sel-12 mutants. by108 derepresses the transcription of hop-1 in the early larval stages. This strain may not be used for commercial purposes.

Superficially WT. byDf1 completely suppresses the Egl defect of sel-12 mutants. byDf1 derepresses the transcription of hop-1 in the early larval stages. byDf1 is a deletion of 31,069 bases from position 3052 of cosmid F46H6 to position 6698 of cosmid C07A12 with a single A base pair insertion. byDf1 deletes F46H6.2/dgk-2, F46H6.4, F46H6.1/rhi-1, C07A12.5/spr-3 and part of C07A12.7. byDf1 is null for spr-3 by sequence and northern analysis. Deletion can be detected with the primers RB1222 CTT ACT AGT ACT AGC TCG CG and RB1224 CCT GTC CAT AAG TGC AGT CC, which give a product of 1540 bp. This strain may not be used for commercial purposes.

Superficially WT. by1-5 strongly suppresses the Egl defect of sel-12 mutants. About 5% of spr-4(by105) I; sel-12(ar171) X double mutants are Egl. This strain may not be used for commercial purposes.

Heterozygotes are WT and segregate WT, Paralyzed Uncs and L3 lethals. ua1 is a deletion of the first 3 full exons of the NADH-ubiquinone oxidoreductase of complex I in the mitochondrial respiratory chain.

Animals with the duplication are WT. Animals which have lost the duplication arrest at 3rd larval stage with increased life span. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

Heterozygotes are WT and segregate WT, Dpy(ts) Steriles and Uncs which arrest in the L3 larval stage. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.