Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h112 arrests as a mid-stage larva). Maintain by picking Unc-13 and checking for correct segregation of progeny.

let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation.

ybIs733 [myo-3::egl-15::BGAR + lin-15(+)]. GFP/RFP chimeric expression of egl-15::BGAR reporter in body wall muscles.