More Fields
Strain Species Genotype
KR435 C. elegans mat-1(h104) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h104 arrests as a sterile adult). Maintain by picking Unc-13 and checking for correct segregation of progeny.
ATD6 C. elegans par-6(zu222) unc-101(m1)/hIn1[unc-54(h1040)] I; unc-119(ed3) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced worms are wild-type and segregate wild-type (heterozygotes), Coil Par (par-6 unc-101 homozygotes; maternal effect lethal), and paralyzed Unc (hIn1 homozygotes). Par phenotype is slightly leaky, but survivors are agametic. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK818. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
HR505 C. elegans unc-59(e261) tba-2(sb51)/hIn1 [unc-54(h1040)] I. Show Description
Dominant temperature sensitive maternal-effect embryonic lethal. Maintain at 15C. Heterozygotes are WT. hIn1 homozygotes are Unc. Early cleavage spindles small and misoriented, cytokinesis often incomplete. Recessive non-temperature sensitive maternal-effect embryonic lethal (but sterile in conjuction with unc-59).
JJ1068 C. elegans hmp-2(zu364)/hIn1 [unc-54(h1040)] I. Show Description
hmp-2(zu364) homozygotes are 99% embryonic or L1 lethal due to a defect in embryonic body elongation; approximately 1% survive to adult stages. Well balanced by hIn1. Maintain by picking WT.
JJ1743 C. elegans par-6(tm1425)/hIn1 [unc-54(h1040)] I; him-8(e1489) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs, dead larvae (par-6 homozygotes) and males.
JK5250 C. elegans pole-1(q831)/hIn1[unc-54(h1040)] I. Show Description
Heterozygotes are fertile WT (non-Unc) and segregate fertile WT (q831/hIn1), fertile Unc (hIn1/hIn1), and sterile non-Uncs (q831/q831). Pick fertile WT and check for correct segregation of progeny to maintain. Reference: Robinson-Thiewes S, et al. G3 (Bethesda). 2022 Mar 4;12(3):jkab439. doi: 10.1093/g3journal/jkab439. PMID: 35100350.
KK818 C. elegans par-6(zu222) unc-101(m1)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc, and Coilers which give only dead eggs (slightly leaky, but survivors are agametic). zu222 is a strict maternal effect embryonic lethal. Partitioning defect similar to that of par-3; fails to localize PAR-3 protein.
KR2151 C. elegans hIn1 [unc-54(h1040)] I. Show Description
Clear, paralyzed. Mutation is included in the hIn1 inversion. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR2837 C. elegans hDf16 unc-59(e261)/hIn1 [unc-54(h1040)] I. Show Description
Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf16 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.
KR2838 C. elegans hDf17/hIn1 [unc-54(h1040)] I. Show Description
Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf17 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.
KR2839 C. elegans hDf15 unc-75(e950)/hIn1 [unc-54(h1040)] I. Show Description
Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf15 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.
ML773 C. elegans rga-2(hd102)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT and segregate WT, dead eggs, and paralyzed Uncs. Stable.
OH10425 C. elegans otIs337. Show Description
otIs337 [unc-86(fosmid)::NLS:::YFP::H2B + ttx-3::mCherry].
OH10434 C. elegans otIs232. Show Description
otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL.
OH10447 C. elegans otIs339. Show Description
otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. Rollers.
PS5551 C. elegans pry-1(mu38)/hIn1 [unc-54(h1040)] I; syIs188. Show Description
syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS968 C. elegans unc-101(sy216)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT and segregate embryonic lethals (sy216 homozygotes) and paralyzed Uncs (h1040 homozygotes). sy216 is a deletion of the unc-101 gene region. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
QP2460 C. elegans hIn1 [umnIs78 unc-54(h1040)]/+ I. Show Description
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim mKate2 expression in pharynx, and segregate heterozygotes (not paralyzed, dim mKate2), homozygous wild-type (not paralyzed, no mKate2), and hIn1 homozygotes (paralyzed, bright mKate2). Pick non-paralyzed, dim mKate2 worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived by crossing parental strain CGC105 (hIn1[umnIs78]) to RG3173 (Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)]) and selecting for the recombined hIn1 worms.
QP2479 C. elegans hIn1 [umnIs75 unc-54(h1040)]/+ I. Show Description
umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim GFP expression in pharynx, and segregate heterozygotes (not paralyzed, dim GFP), homozygous wild-type (not paralyzed, no GFP), and hIn1 homozygotes (paralyzed, bright GFP). Pick non-paralyzed, dim GFP worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived cross of parental strains CGC94 (hIn1[umnIs75]) to QP2460 (hIn1[umnIs78, unc-54(h1040)]/+) and selecting for the recombined hIn1 worms.
RG3145 C. elegans pfd-3(ve645[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)] I. Show Description
Homozygous sterile, Pvl. Deletion of 1266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Pvl, sterile adults (ve645 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)]) homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: cgcgtcaactggaattttctttttccccgg ; Right flanking sequence: ATCAATCTGGCTTGGAGCCAACGTAATGGT. sgRNA #1: aattgagcgtagaaattccg; sgRNA #2: CTCCAAGCCAGATTGATACc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3173 C. elegans Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 Show Description
Homozygous sterile. Deletion of 1965 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults(ve673 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ggaaTCACTTGGTCACTTGTGTAGTATCAC ; Right flanking sequence: aggaatatcacgaaaaaatgcgaaatttgg. sgRNA #1: GCATTTGAATGGAGCGGAGC; sgRNA #2: ccaaaaatgcaatttcagcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3301 C. elegans vps-25(ve801[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [unc-54(h1040)] I. Show Description
Late larval arrest. Deletion of 1316 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear arrested L4 larvae (ve801 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CAAATAAATTTAACGCCTTCATTATCTCCA ; Right flanking sequence: CGGCctgaaaaatgcgtaattccctgaaaa. sgRNA #1: GCTCAATTGATGAATATCGG; sgRNA #2: TGACACCGTCGGTTGAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SA104 C. elegans eya-1(tm759)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT. hIn1 homozygotes are Unc. tm759 homozygous arrest as early larva with incomplete penetrance (60% at 25C, 50% at 20C, 30% at 18C, and 50% at 15C). Viable tm759 homozygotes show various postembryonic phenotypes (Unc, Dpy, Egl, Mig, Muv).
WM104 C. elegans unc-101(sy216) gsk-3(nr2047)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc, and coilers which give only dead eggs (low brood size).