| LSD1091 |
C. elegans |
smg-1(cc546) I; xchEx91. Show Description
xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| LSD1097 |
C. elegans |
smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| LV18 |
C. elegans |
unc-45(wc1) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]
|
|
| LV19 |
C. elegans |
unc-45(wc2) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]
|
|
| LW5558 |
C. elegans |
sma-4(jj278) III. Show Description
sma-4(jj278) worms are small, and the mutation can suppress the sma-9(0) loss of M-derived coelomocyte defect. sma-4(jj278) is a true molecular null allele of sma-4; the 3,556 bp deletion (position: Chromosome III: 5,816,203
.5,819,759) removes almost the entire coding region of sma-4. Reference: McKillop AN, et al. (2018). A new deletion allele of sma-4. microPublication Biology. https://doi.org/10.17912/Z4Z9-CE10.
|
|
| LW905 |
C. elegans |
lmn-1(tm1502) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1502 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| LWA1031 |
C. elegans |
wleSi1852 I; wleSi1565 X. Show Description
wleSi1852 [unc-54p::luciferaseTAG185 + Cbr-unc-119(+)] I. wlels1565 [unc-54p::DanRS_rpr-1::tRNA(CUA)Leu + myo-2p::GFP] X. It is likely that unc-119(ed3) remains in the background. Animals are slightly sick. All animals should express GFP in their pharynx. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| LWA1560 |
C. elegans |
wleSi151 II. Show Description
wleSi151 [unc54p::mCherryTAG156 + Cbr-unc-119(+)] II. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the mCherry reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| LWA1564 |
C. elegans |
wleSi151 II; wleEx35. Show Description
wleSi151 [unc54p::mCherryTAG156 + Cbr-unc-119(+)] II. wleEx35 [unc-54p::DanRS_rpr-1::tRNA(CUA)Tyr + myo-2p::GFP]. Pick animals expressing GFP in their pharynx to maintain wleEx35. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the mCherry reporter is dependent upon expression of temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| LWA1580 |
C. elegans |
wleSi1580 I. Show Description
wleSi1580 [unc-54p::JFF_luciferase + Cbr-unc-119(+)] I. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the Japanese firefly luciferase reporter can be detected using standard luciferase assays. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| LWA1582 |
C. elegans |
wleSi1582 I. Show Description
wleSi1582 [unc-54p::JFF_luciferaseTAG185 + Cbr-unc-119(+)] I. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Expression of the Japanese firefly luciferase reporter can be detected using standard luciferase assays. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| LWA1852 |
C. elegans |
wleSi1852 I; wleSi1853 X. Show Description
wleSi1852 [unc-54p::luciferaseTAG185 + Cbr-unc-119(+)] I. wlels1853 [unc-54p::OmeRS_rpr-1::tRNA(CUA)Tyr + myo-2p::GFP] X. It is likely that unc-119(ed3) remains in the background. Animals are slightly sick. All animals should express GFP in their pharynx. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| LX147 |
C. elegans |
rgs-1(nr2017) III. Show Description
Very weak Egl. rgs-1=C05B7.7, a C. elegans RGS (Regulator of G protein Signaling) gene. nr2017 is a presumptive null allele. nr2017 is a 638 bp deletion of sequences whose limits are CGAGAAATTGTCAACACTAAC...GTTTGGAATGGTTTATCAGTT. The deleted material is replaced by the following 35 bp insertion: TATGTTTAAGTTAAGTTTATAGTTTAAGTTTAAAG.
|
|
| LX160 |
C. elegans |
rgs-2(vs17) X. Show Description
rgs-2=F16H9.1, a C. elegans RGS (Regulator of G protein Signaling) gene. vs17 is a presumptive null allele. vs17 is a 1136 bp deletion of sequences with limits: ATATATATATCTCATTACTGG...AATCAAGTGTAACACTAATAT. rgs-1;rgs-2 double mutants fail to rapidly turn on egg-laying behavior when fed after starvation.
|
|
| LX2060 |
C. elegans |
vsSi32 unc-119(ed3) III. Show Description
vsSi32 [goa-1::GFP + unc-119(+)] III. GOA-1::GFP translational fusion driven by 5kb of goa-1 promoter. Rescues unc-119 locomotion defect. vsSi32 is inserted into the left arm of chromosome III between sequences 5-tttactgcatactgaacaacaggggaaaagggg-3 and 5-tagaattagctgtaagacggcgtctaggttttgca-3. Reference: Kumar S, et al. G3 (Bethesda). 2021 Aug 7;11(8):jkab167. doi: 10.1093/g3journal/jkab167. PMID: 34003969
|
|
| LX2071 |
C. elegans |
goa-1(sa734) I; vsSi32 III. Show Description
vsSi32 [goa-1::GFP + unc-119(+)] III. GOA-1::GFP translational fusion driven by 5kb of goa-1 promoter. Rescues locomotion and body morphology defects, and partially rescues egg-laying defects seen in goa-1 null mutants. vsSi32 is inserted into the left arm of chromosome III between sequences 5-tttactgcatactgaacaacaggggaaaagggg-3 and 5-tagaattagctgtaagacggcgtctaggttttgca-3. Reference: Kumar S, et al. G3 (Bethesda). 2021 Aug 7;11(8):jkab167. doi: 10.1093/g3journal/jkab167. PMID: 34003969
|
|
| LX2404 |
C. elegans |
vsSi39 II; unc-119(ed3) III. Show Description
vsSi39 [goa-1-gfp(Q205L) + unc-119(+)] II. Single-copy mosSCI insertion of the gain-of-function goa-1(Q205L)::GFP translational fusion driven by 5kb of the goa-1 promoter. Animals have shallow body bends and are egg-laying defective. Reference: Kumar S, et al. G3 (Bethesda). 2021 Aug 7;11(8):jkab167. doi: 10.1093/g3journal/jkab167. PMID: 34003969
|
|
| LX242 |
C. elegans |
rgs-3&heri-1(vs19) II. Show Description
Healthy and appears grossly WT. This allele is a 1563 bp deletion of sequences AATTGAGTAGACAAC....GTGTCTTAAATAT. Removes almost all of the 2nd RGS domain. Previously known as cec-9.
|
|
| LX2562 |
C. elegans |
mjIs15. Show Description
mjIs15 [dlg-1::mCherry + lin-15(+)]. [NOTE: the mjIs15 transgene has been incorrectly described in some publications. The correct description of mjIs15 is a dlg-1::mCherry fusion protein and lin-15 rescue construct.] Reference: Lehrbach NJ, et al. Nat Struct Mol Biol. 2009 Oct; 16(10): 10161020. doi: 10.1038/nsmb.1675 PMID: 19713957
|
|
| LX533 |
C. elegans |
rgs-6(vs62) X. Show Description
Deletion removes 1465 bp. Removes start site and majority of RGS domain. Has beginning and end sequences AAAAAGATCGAATATCGGTTGT...TATGACGTAGCACAATATCAGG.
|
|
| LX604 |
C. elegans |
rgs-4(vs93) II. Show Description
231 bp deletion removes all of exons 2 and 3 and throws the remaining portion of the proten (which contains the RGS domain) out of frame. Deletion endpoints are: GCAGCTCACGGAGCCCGGAGTT...CACCGTCGCCAAGACTTAGGTA.
|
|
| LX606 |
C. elegans |
rgs-9(vs95) X. Show Description
This deletion removes most of exon1, all of exon 2, and most of exon 3. It removes a good chunk of the protein region, including the RGS domain.
|
|
| LX636 |
C. elegans |
dop-1(vs101) X. Show Description
167 bp deletion which takes out most of exon 3 and the first 42 bases of exon 4. The first 22 bp of the deletion are: TATGGCTGATATCCGCAGGAAT.
|
|
| LX658 |
C. elegans |
mnDp33 (X;IV)/+ IV; unc-20(e112) rgs-7(vs92) X. Show Description
Heterozygotes are WT. Animals which have lost the duplication are Unc and homozygous for rgs-7. Animals which are homozygous for the duplication are dead. Unc is temperature sensitive. vs92 is a 361 bp deletion which removes the 3' splice site of exon 6, all of exon 7 and half of exon 8. All of the deleted region is within the RGS domain.
|
|
| LX671 |
C. elegans |
ocr-2(vs29) IV. Show Description
Lays 86% of its eggs at the 8-cell or earlier stage.
|
|
| LX677 |
C. elegans |
rgs-7(vs98)/unc-1(n496) lon-2(e678) X. Show Description
Heterozygotes are Unc but not Lon. n496 is dominant. Segregates LonUnc. vs98 homozygotes are non-Unc, non-Lon and are Mel (they give only dead eggs). Strain will break down due to recombination so check for the presence of vs98 by PCR every few generations. Received new stock Feb 2005.
|
|
| LX702 |
C. elegans |
dop-2(vs105) V. Show Description
125 bp deletion. First 22 bp of deletion: AAGTATATTTTATTTTCAGGTA. Last 22 bp: GTGGCCATCATAGTTATGCCAT.
|
|
| LX733 |
C. elegans |
rgs-10&rgs-11(vs110) X. Show Description
This deletion removes sequence 5' to start of rgs-10 and may therefore remove promoter sequence for rgs-10&rgs-11.
|
|
| LX837 |
C. elegans |
vsIs45. Show Description
vsIs45 [tph-1::GFP]. tph-1::GFP in vsIs45 is expressed exclusively in the NSM neurons in larvae and NSM + HSN in adults, whereas other tph-1::GFP reporters are also expressed in other serotonergic neurons; can be used to image NSM development and for FACS isolation of NSM from L1s. Reference: Nelson JC, Colon-Ramos DA. J Neurosci. 2013 Jan 23;33(4):1366-76.
|
|
| LX845 |
C. elegans |
ocr-2(ak47) IV; ocr-1(ok132) V. Show Description
Double mutants have reduced AWA gene expression. ok132 is a deletion and putative null allele. The boundaries of the deletion are: AGATTACTGATGCCATTGAACAAGTTCTCGTCA......TGATGTTTGAAAGGTGGAGT AGCAAAGAGA. ak47 is chemosensory, mechanosensory and osmosensory defective, and is a null allele.
|
|
| LX950 |
C. elegans |
ocr-4(vs137) IV. Show Description
Phenotypically WT. Deletion allele. A "T" is added also. The end points of the deletion are: TCGAACGTCAACAACATATTGCAAAT.....t.....TTGGAAAGGTAGGCTTACACTT TTTTTAA.
|
|
| LX960 |
C. elegans |
lin-15B&lin-15A(n765) X; vsIs97. Show Description
vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab].
|
|
| LX963 |
C. elegans |
lin-15B&lin-15A(n765) X; vsIs100. Show Description
vsIs100 [myo-3p::CFP + lin-15(+)]. CFP expression in VMs. Additional background expression seen as punctate nucleolar fluorescence along the ventral side of the worm (also present in wild-type).
|
|
| LX975 |
C. elegans |
vsIs13 IV; lin-15B&lin-15A(n765) X; vsIs97; vsIs100. Show Description
vsIs13 [lin-11::pes-10::GFP + lin-15(+)]. GFP expression in six VC neurons and posterior intestine. vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab]. vsIs100 [myo-3p::CFP + lin-15(+)]. CFP expression in VMs. Additional background expression seen as punctate nucleolar fluorescence along the ventral side of the worm (also present in wild-type).
|
|
| LX980 |
C. elegans |
ocr-4(vs137) IV; ocr-1(ok132) V. Show Description
vs137 is a deletion allele. A "T" has been added. The endpoints of the deletion are: TCGAACGTCAACAACATATTGCAAAT.......T.......TTGGAAAGGTAGGCTTAC ACTTTTTTTAA. Double mutants have reduced AWA gene expression. ok132 is a deletion and putative null allele. The boundaries of the deletion are: AGATTACTGATGCCATTGAACAAGTTCTCGTCA......TGATGTTTGAAAGGTGGAGT AGCAAAGAGA.
|
|
| LX981 |
C. elegans |
ocr-4(vs137) ocr-2(ak47) IV. Show Description
ak47 is chemosensory, mechanosensory and osmosensory defective, and is a null allele. vs137 is a deletion allele. A "T" has been added. The endpoints of the deletion are: TCGAACGTCAACAACATATTGCAAAT.......T.......TTGGAAAGGTAGGCTTAC ACTTTTTTTAA.
|
|
| LY110 |
C. elegans |
B0399.1(nf110) V. Show Description
Temperature sensitive Egl and Unc. 318 pb deletion including exons 6 and 7. Possibly an allele of exp-3.
|
|
| LY120 |
C. elegans |
twk-7(nf120) III. Show Description
A deletion in F22B7.7 corresponding to base pairs #9512-9815 in the published C. elegans cosmid F22B7 sequence (Genbank accession #L120180. Predicted protein F22B7.7 is part of a family of 2-pore domain potassium channels.
|
|
| MAH242 |
C. elegans |
sqIs24. Show Description
sqIs24 [rgef-1p::GFP::lgg-1 + unc-122p::RFP]. Derived by injection and subsequent integration of plasmids pMH882 and pMH876. Reference: Gelino S, et al. PLoS Genet. 2016 Jul 14;12(7):e1006135. Erratum in: PLoS Genet. 2016 Aug;12(8):e1006271.
|
|
| MAH247 |
C. elegans |
sqIs25. Show Description
sqIs25 [atg-18p::atg-18::GFP + rol-6(su1006)]. GFP+ Rollers. Derived by integration of sqEx4 in MAH145. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.
|
|
| MAH300 |
C. elegans |
sqIs32. Show Description
sqIs32 [sur-5p::argk-1::GFP + rol-6(su1006)]. GFP+ Rollers. Derived by integration of sqEx27 in MAH264. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.
|
|
| MAH677 |
C. elegans |
sid-1(qt9) V; sqIs71. Show Description
sqIs71 [rgef-1p::GFP + rgef-1p::sid-1]. Pan-neuronal expression of sid-1 driven by the rgef-1 promoter. Expression remains neuron-specific until at least Day 10. Animals respond to feeding RNAi against gfp and neuronal genes snb-1 and unc-13. In contrast, animals are resistant to phenotypes induced by feeding RNAi constructs targeting non-neuronal genes pept-1, unc-112, bli-1 and die-1. Reference: Yang Y, et al. Nat Aging 2024 Jan 4. doi: 10.1038/s43587-023-00548-1. PMID: 38177330. MAH677 effectively replaces strain TU3401 sid-1(pk3321) uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1] V., which was found to show RNAi response in non-neuronal tissues.
|
|
| MAH704 |
C. elegans |
sqIs56. Show Description
sqIs56 [rgef-1p::sqst-1::GFP + unc-122p::RFP]. Neuronal over-expression of GFP-tagged p62/SQST-1, a key autophagy substrate. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648.
|
|
| MAH914 |
C. elegans |
sqst-1(syb764) IV. Show Description
Full CRISPR deletion of sqst-1 locus. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648.
|
|
| MAS37 |
C. elegans |
unc-119(ed3) III; abcIs3. Show Description
abcIs3 [pie-1p::ebp-2::GFP + unc-119(+)]. Superficially wild-type. Maternal expression of EBP-2::GFP microtubule end-binding protein. In early embryos, EBP-2 encodes an EB1-like protein (end-binding) that locates to the growing tips of microtubules (not detected on depolymerizing microtubules). A strong fluorescent signal localizes to the centrosome due to high concentration of polymerizing microtubule ends. References: Gusnowski EM, Srayko M. J Cell Biol. 2011 Aug 8;194(3):377-86. Tegha-Dunghu J, et al. Methods Mol Biol. 2014;1136:103-16.
|
|
| MAS94 |
C. elegans |
mei-1(ct46) unc-13(e1091) I; unc-119(ed3) III; abcIs3. Show Description
abcIs3 [pie-1p::ebp-2::GFP + unc-119(+)]. Embryonic-lethal at 25ºC due to dominant gain-of-function mutation mei-1(ct46), and Uncoordinated due to unc-13 mutation. Maternal expression of EBP-2::GFP microtubule end-binding protein. EBP-2 encodes an EB1-like protein (end-binding) that, in early embryos, locates to the growing tips of microtubules. A strong fluorescent signal localizes to the centrosomes of early embryos due to a high concentration of polymerizing microtubules. mei-1(ct46)-based ectopic microtubule severing causes mitotic spindle defects in the early embryo. References: Gusnowski EM, Srayko M. J Cell Biol. 2011 Aug 8;194(3):377-86. Tegha-Dunghu J, et al. Methods Mol Biol. 2014;1136:103-16.
|
|
| MC894 |
C. elegans |
ulp-4(gc54) II. Show Description
Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| MC895 |
C. elegans |
ulp-4(gc55) II. Show Description
Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| MC896 |
C. elegans |
nol-10(gc58) IV. Show Description
Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| MC907 |
C. elegans |
aatf-1(gc63 gc64) I. Show Description
Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). gc63 gc64 occurred in the same mutagenesis; unclear which allele (or if both) is causing the gain of function. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|