Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
HS2326 C. elegans cwn-1(ok546) II; egl-20(n585) cwn-2(ok895) IV/nT1 [qIs51] (IV;V); vpIs1 X. Show Description
vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok546 homozygotes (Unc Egl). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
JCB456 C. elegans algn-12(bet74) V/nT1[qls51] (IV;V). Show Description
Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa.
JCP53 C. elegans dpy-11(e224) ccz-1(t2129) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
JH1580 C. elegans unc-24(e1172) mbk-2(pk1427) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs. mbk-2(pk1427) is a deletion that removes most of the mbk-2 locus.
JH2932 C. elegans unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3614 C. elegans par-1(ax4202[par-1(T983A)]) V/nT1[qIs51] (IV;V); meg-3(ax3054[meg-3::meGFP]) X. Show Description
meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
JH3619 C.elegans par-1(ax4208[meGFP::delta-KA1]) V/nT1[qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
JH3678 C. elegans mex-5(ax3050[mCherry::mex-5])/nT1[qIs51] IV; par-1(ax4209[par-1(T983A)::meGFP])/nT1[qIs51] V. Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type myo-2::GFP+ and segregate non-myo-2::GFP ax3050; ax4209 homozygotes (maternal effect lethal), wild-type myo-2::GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type myo-2::GFP+ and check for correct segregation of progeny to maintain. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.
JJ1238 C. elegans unc-30(e191) mex-5(zu199) IV/nT1 (IV;V). Show Description
Heterozygotes are WT. Embryos from unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.
JJ1244 C. elegans mex-6(pk440) II; unc-30(e191) mex-5(zu199) IV/nT1 (IV;V). Show Description
Heterozygotes are WT. Embryos from mex-6; unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.
JJ462 C. elegans +/nT1 IV; pos-1(zu148) unc-42(e270)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs, Vul and dead eggs. Uncs are homozygous for zu148 and will segregate only dead embryos; the dead embryos will have no morphogenesis and will lack germ cells and intestine.
JJ746 C. elegans +/nT1 IV; apx-1(zu183) dpy-11(e224)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpy, Vul and dead eggs. The Dpys give only dead eggs. apx-1 is a maternal effect lethal. zu183 is recessive.
JK1219 C. elegans unc-34(e315) lag-2(q387) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. [Note from Kimble lab: Min Han did a complementation test on this strain and found that unc-34(e315) is lost from this strain.] Do not distribute this strain; other labs should request it from the CGC.
JK1223 C. elegans lag-2(q411) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. [Used to be listed in Kimble lab as unc-5(e53); lag-2(q411 dpy-11(e224)/DnT1. Needs to be checked.] Do not distribute this strain; other labs should request it from the CGC.
JK1443 C. elegans lag-1(q476) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. Do not distribute this strain; other labs should request it from the CGC.
JK2009 C. elegans gon-4(q519) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs and Steriles with a small white patch. Do not distribute this strain; other labs should request it directly from the CGC.
JK2532 C. elegans gon-1(q518) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, sterile animals with a white patch, and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
JK2663 C. elegans dpy-11(e224) mes-4(bn67) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine. Segregates non-glowing Dpys that are Mes (produce only sterile progeny) and glowing Unc heterozygotes. nT1[unc-?(n754) let-? qIs50] is also known as DnT1[qIs50]. qIs50 is apparently inserted on DnT1. qIs50 is somewhat dimmer than the similar qIs51. Do not distribute this strain; other labs should request it directly from the CGC.
JK2906 C. elegans mep-1(q660) IV/nT1 [qIs51] (IV;V). Show Description
M04B2.1 Throws Steriles and GFP(+) nT1 heterozygotes and dead eggs. The nT1 chromosome is apparently homozygous lethal since Vul worms are not seen. For some reason, crosses with this nT1[qIs51] chromosome generate an excess of male progeny. Do not distribute this strain; other labs should request it from the CGC.
JK2933 C. elegans gon-14(q12) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. q12 homozygotes have a white-patch phenotype. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK2958 C. elegans nT1 [qIs51] (IV;V)/dpy-11(e224) unc-42(e270) V. Show Description
Segregates glowing heterozygotes and DpyUncs. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK3072 C. elegans gon-16(q568) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. q568(ts) homozygotes are sterile and can exhibit a white-patch phenotype. The severity of the white-patch increases with increasing temperature. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK3073 C. elegans gon-15(q574) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. q574 homozygotes are sterile at all temperatures and exhibit a white-patch phenotype at 25C. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK3140 C. elegans gon-1(e2551) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Segregate Gon worms which are GFP-. nT1[qIs51] homozygotes are inviable. Do not distribute this strain; other labs should request it from the CGC.
JK3297 C. elegans fbl-1(q750) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate q750 homozygotes which are GFP- sterile adults, and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
JK3476 C. elegans ceh-22(q632) sma-1(e30) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Segregates Sma, GFP- worms which have partially penetrant gonadogenesis defects. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK4930 C. elegans lag-1(q426) IV/nT1[qIs51](IV; V). Show Description
Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP q426 homozygotes (variable phenotypes including sterile, L1 lethal, and small sterile adults with rectal protrusion and occasional bent pharynx). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kadyk LC & Kimble J. Development. 1998 May;125(10):1803-13. doi: 10.1242/dev.125.10.1803. PMID: 9550713.
JK5455 C. elegans q833 V/nT1[qIs51](IV; V). Show Description
hets are green pharynx WT and segregate green pharynx WT, fertile non-green pharynx and dead eggs (nT1 homozygotes). q833 is a 472 bp deletion into the intergenic region between mir-61/ mir-250 and F55A11.4.
JK6321 C. elegans puf-3(q966) puf-11(q971) IV/ nT1[qIs51] (IV;V). Show Description
Homozygous maternal effect lethal double mutant balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested GFP+ nT1[qIs51] aneuploids, and non-GFP puf-3(q966) puf-11(q971) homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain.
JS345 C. elegans gck-1(km15) V/nT1 [qIs51] (IV;V). Show Description
Maintain by picking GFP+ wild-type worms. Heterozygotes segregate wild-type GFP+ heterozygotes, sterile GFP- gck-1 homozygotes, and dead eggs (nT1 homozygotes). Reference: Schouest et al, Plos ONE 4(10):e7450 (2009).
JT9819 C. elegans unc-24(e138) lin-49(s1198) unc-22(s7) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, lethal Twitchers and dead eggs. Twitchers arrest in early-mid larval development. See also WBPaper00003938.
KIR2 C. elegans capg-2(tm1833) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP capg-2 homozygotes (sick, sterile, Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.
KK288 C. elegans sqt-3(sc8) par-1(b274) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, RolPar (adult homozygotes lay eggs that don't hatch) and dead eggs. nT1[unc-?(n754) let-?] is dominant Unc and recessive lethal. Strict maternal effect. sc8 previously called rol-4(sc8).
KK299 C. elegans par-5(it55) unc-22(e66) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, Twitchers which give only dead eggs, and dead eggs. nT1 heterozygotes are shorter and slower than par-5 unc-22 homozygous worms. par-5 region is not well balanced by nT1: check to make sure that unc-22 homozygotes lay dead eggs. Strict maternal effect lethal.
KK627 C. elegans itDf2 V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs and dead eggs.
KR3627 C. elegans unc-46(e177) mdf-1(gk2) V/nT1 [let-?(m435)] (IV;V). Show Description
C50F4.11. Strain segregates WT, Uncs (give Sterile progeny or progeny with reduced brood size, all of which arrest before hatching (24%), at various stages of larval development (55%), or later) and dead eggs. Rec'd new stock 11/2002. Attribution: Paper_evidence WBPaper00005604
LG340 C. elegans skn-1(zu135) IV/nT1 [qIs51] (IV;V); geEx1. Show Description
geEx1 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Pick Rolling GFP+ and check for correct segregation of progeny to maintain. skn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Reference: Nature (2007) 447(7144):545-9.
LG348 C. elegans skn-1(zu135) IV/nT1 [qIs51] (IV;V); geIs9. Show Description
geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.
LG357 C. elegans skn-1(zu135) IV/nT1 [qIs51] (IV;V); geIs10. Show Description
geIs10 [ges-1p(long)::skn-1c::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.
LL1009 C. elegans hsp-90(nr2081)/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and arrested larvae. Published as LL1008. Previously known as daf-21.
MH2285 C. elegans lin-66(ku423) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. ku423 homozygotes have delayed heterochronic phenotype and are L4 lethal.
MLC903 C. elegans nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X, lucIs24. Show Description
lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MT1000 C. elegans unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT.
MT11713 C. elegans mep-1(n3702) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, PvlSte, and dead eggs.
MT12755 C. elegans ceh-32(ok343) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. ok343 is lethal or has a linked lethal.
MT13172 C. elegans mys-1(n4075) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. The myo-1(n4075) deletion removes 1010 nucleotides from the mys-1 locus (VC5.4). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 106 and ends at about nt. 1115 to give the junction sequence GATGCCGGT/TCTGCGTGGG.
MT1337 C. elegans lin-12(n137) III; nT1 (IV;V). Show Description
MT1338 C. elegans lin-31(n301) II; nT1 (IV;V). Show Description
MT1341 C. elegans lin-12(n302) III; nT1 (IV;V). Show Description
Vulvaless.
MT14725 C. elegans sfa-1(n4562) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.