Search Strains

More Fields
Strain Species Genotype Add
AG152 C. elegans unc-85(e1414) bli-2(e768) dpy-10(e128) II. Show Description
Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters.
AG226 C. elegans rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Show Description
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1.
AH1747 C. elegans unc-119(ed3) III; zhIs35 I. Show Description
zhIs35 [let-23::GFP + unc-119(+)] I. zhIs35 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene expression is higher in this strain than in AH1779 unc-119(ed3) III; zhIs38. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
AH1779 C. elegans unc-119(ed3) III; zhIs38 IV. Show Description
zhIs38 [let-23::GFP + unc-119(+)] IV. zhIs38 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene is expressed at levels similar to endogenous LET-23. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
AH75 C. elegans apr-1(zh10) unc-29(e1072) I; zhEx11. Show Description
zhEx11[apr-1(+) + sur-5::GFP]. Unc. Segregates dead eggs that have lost the rescuing array.
AM141 C. elegans rmIs133. Show Description
rmIs133 [unc-54p::Q40::YFP]. AM141 animals show a soluble Q40::YFP distribution in body wall muscle cells immediately after hatching. As these worms age the rapid formation of foci is observed. When they reach adulthood, AM141 animals show an entirely Q40::YFP aggregated phenotype.
AP36 C. elegans mep-1(ok421) IV/nT1 [qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok421 homozygotes, wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Received new stock 12/02.
APL126 C. elegans ljfSi33 I; ljfSi10 II; egl-17(ljf14[egl-17p::mNG::3xFlag]) X. Show Description
ljfSi33 [myo3p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. Sex myoblast migration defects, Egl. EGL-17::mNG expression in body wall muscles. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi33 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL130 C. elegans ljfSi10 II; egl-17(ljf25[egl-17::mNG::nlg-1 C-terminus]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Endogenously membrane tethered allele of EGL-17::mNG that is competent for contact-dependent signaling but does not diffuse extracellularly. egl-17(ljf25) was generated by inserting mNG and the transmembrane and C-terminal domains of NLG-1 at the C-terminus of egl-17. Sex myoblast migration defects, Egl. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL199 C. elegans ljfSi10 II; egl-17(ljf24[egl-17::SL2::mNG::PH]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Endogenously engineered transcriptional reporter that can be used to visualize membranes of egl-17-expressing cells. egl-17(ljf24) was generated by inserting SL2::mNG::PH following the egl-17 stop codon. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL23 C. elegans ljfSi10 II; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL242 C. elegans ljfSi32 I; ljfSi10 II; egl-17(ljf14[egl-17p::mNG::3xFlag]) X. Show Description
ljfSi32 [egl-20 enhancer(-1261 – 610)::pes-10p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN]) I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Sex myoblast migration defects, Egl. EGL-17::mNG expression in a small number of posterior cells leads to posterior sex myoblast migration in hermaphrodites. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. ljfSi32 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL31 C. elegans lin-12(ljf31[lin-12::mNeonGreen[C1]::3xFLAG]) III. Show Description
mNG and 3xFLAG tags fused to the C-terminal end of the intracellular domain of the endogenous lin-12 locus using a 9 amino acid flexible linker. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
APL5 C. elegans ljfSi2 I. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. Single-copy transgenic strain that expressing mTurquoise2::PH plasma membrane marker and mKate2::moesin actin binding domain in the M lineage. lfjSi2 was inserted at Chr I:2851088, near ttTi4348, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL622 C. elegans ljfSi2 I; ljfSi39 IV; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
AS270 C. elegans gly-12(id47) X. Show Description
Phenotypically WT. F3.2 See also WBPaper00005927.
AS271 C. elegans gly-14(id48) III. Show Description
Phenotypically WT. M8ns. See also WBPaper00005927.
AU133 C. elegans agIs17 IV. Show Description
agIs17 [myo-2p::mCherry + irg-1p::GFP] IV. GFP in pharynx and intestine that turns on upon infection with pathogenic Pseudomonas aeruginosa strain PA14. Reference: Dunbar TL, et al. Cell Host Microbe. 2012 Apr 19;11(4):375-86.
AU78 C. elegans agIs219 III. Show Description
agIs219 [T24B8.5p::GFP::unc-54 3' UTR + ttx-3p::GFP::unc-54 3' UTR] III. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
AUM1695 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I. Show Description
V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1747 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz146[PAZ deletion]) I. Show Description
282bp deletion (247aa-345aa) in PAZ domain of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1760 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz151[D583A]) I. Show Description
Inactive RNase mutation of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1787 C. elegans cosa-1(viz154[GFP::cosa-1]) III. Show Description
GFP tag inserted at N-terminus of endogenous cosa-1 locus. Expressed primarily in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1811 C. elegans plk-3(viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. Expressed primarily in both male and hermaphrodite gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1863 C. elegans sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
AUM1880 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AV125 C. elegans spe-8(hc40) I; dpy-4(e1166) IV. Show Description
Can be maintained by chunking or setting up male/hermaphrodite crosses. Dpy.
AV221 C. elegans unc-119(ed3) meT8 (III); meIs4 meT8 (IV); meIs1. Show Description
meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1.
AV267 C. elegans syp-3(me42)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. Segregate syp-3(me42) homozygotes that are non-GFP and lay mostly dead eggs; these mutants form abnormal synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable.
AV276 C. elegans syp-2(ok307) V/nT1 [unc-?(n754) let-?(m435)] (IV;V). Show Description
Balanced heterozygotes are Unc and segregate Unc (heterozygotes), non-Unc syp-2(ok307) homozygotes, and dead eggs (nT1 homozygotes). syp-2(ok307) homozygotes are viable and non-Unc. They produce 96% dead eggs and 44% males; cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes.
AV280 C. elegans unc-119(e2498) III; him-17(ok424) V; meIs5. Show Description
meIs5 [him-17::GFP + unc-119(+)]. him-17::GFP is expressed in the germline. meIs5 not mapped.
AV307 C. elegans syp-1(me17) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc syp-1(me17) homozygotes, and dead eggs (nT1 homozygotes). syp-1(me17) homozygotes produce 95% dead embryos and 38% males. Cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine.
AWR41 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I. Show Description
N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR45 C. elegans pals-22(kea8[pals-22::GFP::degron]) III. Show Description
C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR54 C. elegans lin-35(kea7[lin-35p::AID*::GFP::lin-35]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. N-terminal AID*::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of eft-3p::TIR1::mRuby allows auxin-inducible degradation of LIN-35 in somatic tissues. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR56 C. elegans lin-35(kea7[lin-35p::AID*::GFP::lin-35]) I; ieSi64 II. Show Description
ieSi64 [gld-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. N-terminal AID*::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of gld-1p::TIR1::mRuby allows for auxin inducible degradation of LIN-35 in the germline. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR58 C. elegans lin-35(kea7[lin-35p::AID*::GFP::lin-35]) I; keaSi10 II. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. N-terminal AID*::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR59 C. elegans keaSi10 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of PALS-22 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR61 C. elegans keaSi11 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
keaSi11 [vit-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of vit-2p::TIR1::mRuby allows for auxin inducible degradation in the adult intestine. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR62 C. elegans keaSi9 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
keaSi9 [myo-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of myo-3p::TIR1::mRuby allows for auxin inducible degradation in the body wall muscles. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR63 C. elegans keaSi12 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
keaSi12 [dpy-7p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of dpy-7p::TIR1::mRuby allows for auxin inducible degradation in the epidermis. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR64 C. elegans kea15 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
kea15 [rgef-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of rgef-1p::TIR1::mRuby allows for auxin inducible degradation in neurons. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AX301 C. elegans npr-1(ad609) lin-15B&lin-15A(n765) X; dbEx35. Show Description
dbEx35 [npr-1::GFP + lin-15(+)]. Pick Non-Muv to maintain. Solitary feeders. GFP is expressed in approximately 20 neuron types. Reference: Coates JC, de Bono M. 2002 Nature 419: 925-929.
AY143 C. elegans flp-21(ok889) V; flp-18(gk3063) X. Show Description
Superficially wild-type. Reference: Singh J & Aballay A. Dev Cell. 2019 Apr 8;49(1):89-99.e4.
AZ235 C. elegans unc-119(ed3) III; ruIs48. Show Description
ruIs48 [pie-1::tubulin::GFP + unc-119(+)]. Homozygous expression of GFP::tubulin fusion in germline and early embryos. Insertion unmapped. pAZ147.
AZ244 C. elegans unc-119(ed3) III; ruIs57. Show Description
ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Homozygous expression of GFP::tubulin fusion in germline and early embryos. Insertion unmapped. pAZ147.
BA1013 C. elegans spe-6(hc49) vab-7(e1562)/qC1 [dpy-19(e1259) glp-1(q339)] III; spe-27(it132) IV. Show Description
Male/hermaphrodite line. Maintain at 15C to insure maintenance of male/hermaphrodite line.
BA1044 C. elegans spe-27(it132) spe-29(it127) IV; him-5(e1490) V. Show Description
Non-conditional hermaphrodite sterile. Males fertile. Self-progeny produced after mating.
BA1051 C. elegans spe-12(hc76) I; spe-29(it127) IV; him-5(e1490) V. Show Description
Self-sterile hermaphrodites; fertile males. Mated hermaphrodites produce self and outcross progeny. Self progeny are 33% males.
BA1073 C. elegans dyf-5(hc183) I. Show Description
Deletion allele of M04C9.5 (mak-kinase). No visible phenotype in hermaphrodites. Primers HES 186/187 outer and HES 188/189 inner.