Search Strains

Heterozygotes are WT and segregate WT and Sterile animals with a protruding vulva. Throws males. Clone several WT to recover heterozygote. Cytoplasmic dynein light intermediate chain. 9/02: ku266 is not an L to stop; it is a W117 to a stop (TGG to TGA). Sandhya Koushika.

Heterozygotes are Unc. ku423 homozygotes have delayed heterochronic phenotype and are L4 lethal.

Semi-dominant suppressor of let-60(n1046). Strong reduction of function mutation. At 20C: <1% Muv, 24% Egl, 6% larval lethal, and SM migration defects.

Heterozygotes are WT and segregate WT, Dpys and lethals.

Reference: Cohen ML, et al. PLoS Genet. 2015 Mar 27;11(3):e1005099.

wIs51 [SCMp::GFP + unc-119(+)] V. kuEx194 [elt-1(+) + sur-5p::DsRed]. GFP expression in seam cells. Pick DsRed+ animals to maintain. In a daf-12(WT) background, elt-1(ku491) exhibits some precocious fusion of seamcells and gaps in alae. elt-1(ku491); daf-12(rh61rh411) double mutants have more sever heterochronic phenotypes including seamcell proliferation and bursting vulvae. Reference: Cohen ML, et al. PLoS Genet. 2015 Mar 27;11(3):e1005099.

Superficially wildtype. Homozygous nprl-3(ku540) can suppress the early larval arrest phenotype of mmBCFA deficiency mutants elo-5(gk208) and cgt-1(tm1027) cgt-3(tm504). References: Zhu H, et al. Elife. 2013 May 21;2:e00429. Zhu H, Sewell AK, Han M. Genes Dev. 2015 Jun 15;29(12):1218-23.

Weak hypomorphic allele of lin-45. Animals are Dpy but otherwise appear normal.

Weak hypomorphic allele of lin-45. Animals are Dpy but otherwise appear normal. Occasional larval lethality.

Slow growing. Maintain under normal conditions. Derived from parental strains RB754 [aak-2(ok524)] and VC199 [sir-2.1(ok434)]. Reference: Schmeisser S, et al. Molecular Metabolism February 15, 2013. DOI: 10.1016/j.molmet.2013.02.002.

Resistant to tetradecanoyl phorbol acetate. Semi-dominant.

Animals grow to be adults with smaller than normal body size and produce a reduced number of progeny on TPA-containing medium. No other apparent phenotypes were so far observed on NGM. Tc1 was originally inserted into a 2.4 kb HindIII genomic fragment. The 1.8 kb portion adjacent to the 3' end of the inserted Tc1 was replaced by an unidentified 1.0 kb fragment probably due to rearrangement during backcrossing.

Temperature sensitive, maintain at 15C. At 25C the embryos arrest at the lima bean stage. Will grow at 20C.

qbcSi9 [mex-5p::GFP::his-58::3XmiR-228::tbb-2 3’UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

qbcSi10 [mex-5p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

qbcSi11 [elt-1p::GFP::his-58::3XmiR-228::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

GFP::3xFLAG tags inserted at N-terminus of endogenous lin-45 locus. Wild-type morphology. Reference: Townley R, et al. Sci Signal. 2023 Aug 29;16(800):eabq4355. doi: 10.1126/scisignal.abq4355. PMID: 37643243.

Heterozygotes are WT and segregate WT, DpyUncs, and dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).

mcEx337 [vha-5(+)::GFP + rol-6(su1006)]. Animals with the array are Rollers and GFP+ in the excretory canal. Animals which have lost the array are dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).

mcEx342[vha-5(E830Q)::GFP + rol-6(su1006)]. Animals with the array are slightly Dpy and are occasionally Rollers and GFP+ in the excretory canal. Animals which have lost the array are dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID*) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

vha-11 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

vha-1 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

vha-13 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

vha-14 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

vha-8 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

vha gain-of-function alleles created by replacing the miR-1 binding sites (ACATTCCA) in the 3' UTRs of the endogenous loci with a NotI (GCGGCCGC) restriction site. (vha-12 gain-of-function allele was created by replacing three miR-1 binding sites (ACATTCCA) with NotI (GCGGCCGC), BamHI (GGATCC), and EcoRI (GAATTC) restriction sites.) Referred as 6x-vhaNotI. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

dct-1 gain-of-function allele created by replacing two miR-1 binding sites (ACATTCCA) in the 3' UTR of the endogenous locus with NotI (GCGGCCGC) restriction sites. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

lucEx1207 [myo-3p::YFP]. Pick YFP+ to maintian. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

tbc-7 gain-of-function allele created by replacing two miR-1 binding sites (ACATTCCA) in the 3' UTR of the endogenous locus with NotI (GCGGCCGC) and BamHI (GGATCC) restriction sites. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

luc40 is a deletion of mir-790. luc40 mutants respond normally to CO2 as compared to mir-791(lf) animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. lucEx1311 (myo-3p::R2pH::LAMP1::3xFLAG::unc-54 3’UTR + ttx-3p::mCherry). Pick mCherry+ to maintain. Reference: Gutierrez-Perez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

Superficially wild-type. CRISPR/Cas9-engineered mir-1820 deletion allele; miRNA hairpin replaced by unc-119.

lucEx421 [mir-4813p::myr::GFP::unc-54 3’UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Reporter contains 1kb upstream mir-4813 promoter sequence and 1kb unc-54 3’UTR downstream sequence. Provides a marker for pharyngeal muscle cell-cell fusion. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

Coils. Backs fairly well. The coiling phenotype is semi-dominant.

Animals move sluggishly but are able to back, despite n491. lb125 also partially suppresses the tail touch insensitive phenotype of u38 in cold-sensitive fashion: at 25C -> 0%; at 20C -> 5%; at 15C -> 30%.

lb130/+ dominantly suppresses the e15 backing defect and causes recessive sterility. Three phenotypes are present in this strain: backing steriles (lb130 homozygotes), backing fertiles which are bloated (heterozygotes), and non-backing coiled Unc animals which are fertile and bloated (sup-40(+)). Maintain strain by picking fertile animals which can back. egl-1(n487) is included in the strain to facilitate identification of lb130 homozygotes, which grow slowly; their sterility contrasts with the bloating of lb130/+ heterozygotes.

Intragenic unc-8 revertant. Appears wild type. Probable null allele.

lbEx9 [R31A1(cosmid) + rol-6(su1006)]. Pick non-Unc Rol to maintain. This strain was obtained by co-injection of plasmid pRF4 and cosmid R13A1 into gonads of unc-8(e15) animals. Reference: Shreffler W, Wolinsky E. Behav Genet. 1997 May;27(3):211-21.

WT. lb88 is a recessive X-linked suppressor of unc-8 dominant mutations.

Dpy.

WT.