| RG3304 |
C. elegans |
F27D9.2(ve804[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 3038 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGAAATGGGAGGAGACACGATTGAAACAG ; Right flanking sequence: TGGATTATATTGCGTGTGAGAATGGTTCCA. sgRNA #1: GAGAGAAAATTCTAGATGAC; sgRNA #2: TGGTAGTCCTTATTAGTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3305 |
C. elegans |
F20D1.3(ve805[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATATGCAGCAACTTAAGAtttttttttCA ; Right flanking sequence: TATCCAACTCAGAAGAAGAAGAAGAGCTGC. sgRNA #1: GATTTGGCGCATCAACTGCA; sgRNA #2: GTAGGCATTCTGTCCATCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3306 |
C. elegans |
F40A3.3(ve806[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 757 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ataaaaaaataaatTAAGGATGGTCGTCCT ; Right flanking sequence: CGGAGCATGAGTTGTTCTTCTGTAAAATTG. sgRNA #1: GGAGCAGAGATCTCGTTACC; sgRNA #2: CCAATTCTCAACAAGCAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3307 |
C. elegans |
+/nT1[umnIs49] IV; xpo-1(ve807[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval arrest. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve807 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TCAAACTTATAGTTTTCTTTTTTCAGGTCT ; Right flanking sequence: TGGTGTGACCTGGTTTATTTTCAATCGAAA. sgRNA #1: CGACATTCTCAAAGAATTAC; sgRNA #2: AGATGAGGATATGCGTTAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3308 |
C. elegans |
C15H9.4(ve808[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30 [ubc-17(tmIs1243)] X. Show Description
tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous animals may be sensitive to starvation (grotty, low brood size). Deletion of 1634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, wild-type GFP+ non-mCherry (ve808 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TACTATATTCTGTTATTCCAAAATGCGTTT ; Right flanking sequence: ATAATGTGAACAGCACGCAAAACGGAACAA. sgRNA #1: GTTCCAGATGACAACAGACT; sgRNA #2: TGTCAAATCAGCTTTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3309 |
C. elegans |
egrh-2(ve809[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 5538 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCTATCGGTTCGCAAATGTCATTACCG ; Right flanking sequence: cccACTTTTAATCTGAAATTTTGTATAAAA. sgRNA #1: GTGTGTCGGAGGAAGAAACA; sgRNA #2: aaattgctttaatgcctatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3310 |
C. elegans |
C28F5.4(ve810[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2762 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTCTTTCGTGATTCTTTTTGAAATGCCA ; Right flanking sequence: TTCCTAAGAAGAGCATATGCTCGCAGAAGT. sgRNA #1: GGACGCAATAAAGAAGTGCG; sgRNA #2: CTGCCAAATATCCGTCAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3311 |
C. elegans |
fars-2(ve811[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous Ste, Pvl, Unc. Deletion of 3213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ Ste, Pvl, and Unc animals (ve811 homozygotes) and arrested non-GFP (stage unknown, some uncharacterized non-GFP hermaphrodites develop into fertile adults) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. Left flanking Sequence: ggtttttcagtgctcttcgtattacCTCCT ; Right flanking sequence: TTCGTCTTTCGAGTAGAGCCGAACACCTTC. sgRNA #3: TGAAAGAGCACTTACCAAGG; sgRNA #4: CTACTCGGCAAAAAGCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3312 |
C. elegans |
gdh-1(ve812[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve812 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTTAATTACAAAATATTTTATTTTCAGGTA ; Right flanking sequence: GTACCCACTTCTCACTCATCTCATGGCTCT. sgRNA #1: ATGTTGAGCACTCTTTCCAG; sgRNA #2: TTATGTGAAGGTGAATCCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3313 |
C. elegans |
arrd-4(ve813[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCAACGTTGACCTTCAAAGCAGTAGCTTC ; Right flanking sequence: cggcagtttgctgcaacttattgcccaacc. sgRNA #3: TCCAATGCAGTTGCTTGAGT; sgRNA #4: acctcgtcgtttcagccaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3314 |
C. elegans |
asp-19(ve814[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAAAACCTAGACCAACAATGGTTGCAATT ; Right flanking sequence: AGTGCATCTCATGAAAAAAATAGAGACGGG. sgRNA #1: ACCATTACAAAGCAAGAGCT; sgRNA #2: TGCTGTTTTGTAGCTCACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3315 |
C. elegans |
gpd-4(ve815[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTCATTCAAGTTTTCTTACAGACTCAAA ; Right flanking sequence: TGGAGCATGCATTTCGCTCAACCCGAACTT. sgRNA #1: AAAATGTCGAAAGCCAACGT; sgRNA #2: GTATCGAAAATGGACGAGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3316 |
C. elegans |
lrp-1(ve816[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest, Mlt. Deletion of 15775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve816 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTGGTTGTCAAGCAGGTTGCCATCCATCA ; Right flanking sequence: CACGTCAGCATCTGCAATGTCACCAAACAG. sgRNA #1: CACGTACATTCACCTCCATG; sgRNA #2: GATGGCTGATCATTTGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3317 |
C. elegans |
F44E5.5(ve817[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2259 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGAGAAAAAGAAAGAGGGAGACAGAGTG ; Right flanking sequence: AATGTTGTTCTAATAAATTTACAAAAATCT. sgRNA #1: TCTAGAAGATGTTACGGGAA; sgRNA #2: AACAGGCATACATTAAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3318 |
C. elegans |
+/mT1 [umnIs52] II; prx-10&wrs-2(ve818[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval arrest/sterile. Deletion of 3348 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae/sterile adults (ve818 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TCAGCGAAGAGATGAAGAGTATATTGAAGA ; Right flanking sequence: ACTGAAAATGGTGAAAAGGCTCGAGAAATT. sgRNA #1: TATTACAGAAAGATTGAGCA; sgRNA #2: TAGCACTTTGTCAACCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3319 |
C. elegans |
+/mT1 [umnIs52] II; wrs-2(ve819[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 1420 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve819 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGTTGATCAACACGCTATTTCACTTGGACC ; Right flanking sequence: ACTGAAAATGGTGAAAAGGCTCGAGAAATT. sgRNA #1: ACTTCCAGCAAATGAGGTTG; sgRNA #2: TAGCACTTTGTCAACCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3320 |
C. elegans |
got-1.2(ve820[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1449 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCTTGGCGACATATTCCACGTTTTTCGTGT ; Right flanking sequence: AGGTACATCTTGTTCTTGTGGAACACCTCG. sgRNA #1: TAAGACCACAAATGTTGATG; sgRNA #2: TGACGGGAGCCGTCTCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3321 |
C. elegans |
ile-1(ve821[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1699 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAATGCAATAAATTAGTAGAATTTGGCCT ; Right flanking sequence: ATCTGGAATGCAAATGTTTGCTTAGCGAAT. sgRNA #1: TGTACGAAGCAAGCAAGACA; sgRNA #2: TTCCAGATATGACCTCATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3322 |
C. elegans |
got-2.1(ve822[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2683 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCAACTCTGGATTACTCAAAATCCGTGAA ; Right flanking sequence: CGGGAGCACTGGTTGAGCAGTTACAGTAGT. sgRNA #1: GCAATTCTTGCTCCATGAAG; sgRNA #2: AGCGGCACATTTCTGAACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3323 |
C. elegans |
ostb-1(ve823[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Emb. Deletion of 1090 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead eggs (ve823 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TGATCTTTGACCATCTCTTCATTCTTGCCC ; Right flanking sequence: TCGTTCTCAATGATGGCGGGACTCGTGTTG. sgRNA #1: TCCGAAGACTTGAACCCCTG; sgRNA #2: AGAGGCGTAGTATGGATATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3324 |
C. elegans |
C34F6.1(ve824[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 2843 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACCATATCGCTTCTCAAAGTTATTGCATG ; Right flanking sequence: GTTGCATGAGATTGGAGTGGAGAATTCGTT. sgRNA #1: GTCCCGAGTCGCGAGCTGAG; sgRNA #2: TACTTGAACCAACCAAACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3325 |
C. elegans |
W06A7.4(ve825[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1716 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAGATTCGGTCTATTTGGTGTACCTTCCG ; Right flanking sequence: CACTTTTCGGAGTTCTTGTTATAACAGCGT. sgRNA #1: TAAAATGCTCATTGGAACGG; sgRNA #2: TGAAGCCGTATGCAGTACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3326 |
C. elegans |
ZK353.9(ve826[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 2281 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGCAGAGCACATTCCAGAAGTTCCAGGTGA ; Right flanking sequence: GGGACTTTTCTAAaataattaattattgat. sgRNA #1: TATCGTAGCGATACACGTCA; sgRNA #2: ATTCCAGATGCTGTTGCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3327 |
C. elegans |
T06E6.1(ve827[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous early larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ arrested larvae (ve827 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CGTCGGATGATTTTTTCGCCCTTTTCACCG; Right flanking sequence: AGGTAATCTCATCGCTTTTCGGGTCAAGGG. T06E6.1 sgRNA #1: CGTGTGGGGAGTGATGGAAC; T06E6.1 sgRNA #2: CTCGTCATTCCAGATCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3328 |
C. elegans |
nsun-1(ve828[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/lin-42(tmIs1226) II. Show Description
tmIs1266 [myo-2p::mCherry, II: lin-42] II. Homozygous larval arrest. Deletion of 1509 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ arrested larvae (ve828 homozygotes) and mCherry+ animals [lin-42(tmIs1226) homozygotes]. Maintain by picking wild-type GFP+ mCherry+. Note: recombination is possible and should be evident by the presence of non-fluorescent animals that are neither GFP+ nor mCherry+. Note from parent strain FX30266: Egl phenotype of lin-42 is not detectable. Left flanking Sequence: CAAAAACTGATTTTTCTGAAATCTAGTCCG; Right flanking sequence: GAGTACACGAGATATCCTGGAAAATTAGAT. nsun-1 sgRNA #1: ATGACGGTTTCAATACGGTA; nsun-1 sgRNA #2: CACGTGCTCTGTACTCGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3329 |
C. elegans |
dsl-7(ve829[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 749 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACAAATGTTCCAATTGAATTCGATCAACCT ; Right flanking sequence: AGGGGCGACCTGTTAGACTAAATTCACAGT. sgRNA #1: GCAAGTATCATAATAAGAAG; sgRNA #2: ATCCACACCATATTTCCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3330 |
C. elegans |
C16C8.18(ve830[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCGAAAATCGGAAGAAAAAGTTCAACGAT ; Right flanking sequence: AAGCTGAAGTCTGTGAAGATTTGATAACTC. sgRNA #1: GATGAGCAGTAGTATCGAAG; sgRNA #2: CTTCTCGAGCAAAAGAGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3331 |
C. elegans |
Y8A9A.2(ve831[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 4848 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTATTCGAATCTTTTTTATAGGGTACCC ; Right flanking sequence: AGAACTTCTTGCTGTGCTCCATACAAGAAG. sgRNA #1: TGCTTTGAGAAGCATTCTGG; sgRNA #2: TGGGAAGAGACAGACCGAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3332 |
C. elegans |
skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3333 |
C. elegans |
nep-11(ve833[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2722 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATATCTTCGAATCTCTCATCCAAGTACCT ; Right flanking sequence: TTTCACTGATAGTTATCAGTTGCATCTGAC. sgRNA #1: GAGTTGTCCAGTCAAACGTG; sgRNA #2: ATAGTGATATACCTACTCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3334 |
C. elegans |
skr-15(ve834[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 474 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTGCTGCTCCAATCGCCGAAGAAGCCA ; Right flanking sequence: AGGCATCTGCAACTTCTGCTGATACAACTG. sgRNA #1: GCTGTAGTAGACGACTGGGG; sgRNA #2: GTTTGGCAAGGAGAAGACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3335 |
C. elegans |
nep-6(ve835[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 3709 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTCTGCGAAAGATAAGCTGGCCAATCCT ; Right flanking sequence: ATATGCCACAATTTGCGACAGCATTCAACT. nep-6 sgRNA #1: AACACGACTAGAGCAATCAG; nep-6 sgRNA #2: TGGAAAAGATCCCATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3336 |
C. elegans |
C33A12.3(ve836[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1844 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATATATTGGAAATTTCTAAATTTAAAGCCA ; Right flanking sequence: TGGTCGGTTTGTACCATATTCCACATGACT. C33A12.3 sgRNA #1: GGGCTGGGCACTATTGACAC; C33A12.3 sgRNA #2: TGACGATCTCGAGAAAGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3337 |
C. elegans |
vha-18(ve837[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTCAGCAGACGCATCATTGCTTCTTTACCA ; Right flanking sequence: TTTGAAACTGAATCAAAGAAAATTAACTTT. vha-18 sgRNA #1: CTTAAAGTGGAACAACTCGG; vha-18 sgRNA #2: CAGTTTCAAAATGGTATTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3338 |
C. elegans |
C25G4.2(ve838[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 673 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCTCTCTCATAAATCCGGCAATCTTCTCCT ; Right flanking sequence: AGGCAGAGGATCCGGAGTTTCGGTTGGGAA. C25G4.2 sgRNA #1: ACCGTCGATGTCAAAGCACA; C25G4.2 sgRNA #2: CGCATTGTCGATATCCGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3339 |
C. elegans |
ptrg-1(ve839[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3983 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGATTTTCACCTTCGAGGCAAAAATACCA ; Right flanking sequence: GAACTGAAACTGAAAATCGAAGAATTGGTC. ptp-4 sgRNA #1: TCGTATACCGAAATTCAGTG; ptp-4 sgRNA #2: GCACCGTTTCTGATAACACA. ptrg-1 formerly known as ptp-4. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3341 |
C. elegans |
phf-5(ve841[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 2354 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve841 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TGTGTGATTTGTGATTCACATGTTCGTCCA; Right flanking sequence: AGGATCGTGACGGATGCCCGAAAATTGTGA. phf-5 sgRNA #3: CAGATACGAACCAATGTACA; phf-5 sgRNA #4: AGAATGCACAATTCTCGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3342 |
C. elegans |
xpd-1(ve842[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 11823 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve842 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. [NOTE: xpd-1 is located near the end of the region of LG III balanced by sC1, thus not known if truly balanced by sC1.] Left flanking Sequence: CCGGATAAGCTTGATAAGCTTGTCTATTGT; Right flanking sequence: AGTTATTACGCTATCATGTCATGATGCTTC. xpd-1 sgRNA #1: TCCAGAACTATTCCAGGTAG; xpd-1 sgRNA #2: GCCAGTTGACTACCATCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3343 |
C. elegans |
marc-5(ve843[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 6603 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. This indel also deletes tRNA Y57A10B.t1. Left flanking Sequence: GGGTAAGAAGGACCATAAGCCTACTCGAGC ; Right flanking sequence: CTGATGCTGCAAAAATTAGAAAAAATACGT. marc-5 sgRNA #1: ACAATCACAGAACTCCGCAG; marc-5 sgRNA #2: TATTTGTCTCAACAACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3344 |
C. elegans |
Y57G11C.1147(ve844[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve844 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ACGGACGACTCTTCCGGCAGTTGCAGACAT; Right flanking sequence: TCAACGCTGAAAAGCTGAAAAACGGTGAAG. Y57G11C.1147 sgRNA #1: GAGTATCTCCTTTGGTGACA; Y57G11C.1147 sgRNA #2: TCAGCGTTGAATGCACGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3345 |
C. elegans |
ppfr-1(ve845[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 5994 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGGATCCATAGGTATATCCAGTTCATCCT ; Right flanking sequence: TAAAATCATCCGATGTGTCTTCCGAAAATG. ppfr-1 sgRNA #1: TGAGAATGTTAAGAATACTG; ppfr-1 sgRNA #2: GAACACTTCCTAAAGATACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3346 |
C. elegans |
C25E10.5(ve846[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGTTGATCATTGTCGCTGGAATAGTTTCCG ; Right flanking sequence: TGGCTCATCAAATCATCCGTTTTCTTCGCA. C25E10.5 sgRNA #1: ATTTTCCACGGCATTCAATG; C25E10.5 sgRNA #2: TAGTGGTCCAACTCCCAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3347 |
C. elegans |
F59E11.2(ve847[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1484 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGGGTGTTATACTACAAGATCAAGTGGCT ; Right flanking sequence: GGGTAATCTGGCAAAGTGTAAACCGCTTTT. F59E11.2 sgRNA #1: CTTGTCACAGGTGCTTCCCG; F59E11.2 sgRNA #2: ACAAATCAAGCTACCAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3348 |
C. elegans |
+/nT1 [umnIs49] IV; trpp-6(ve848[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval lethal. Deletion of 605 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate grotty late larval to sterile (ve848 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGAAATTATCCGTTCAACTTTGGAAAGTGA; Right flanking sequence: CCTTGCTGGTCTTAATATTAGAGTGAGTTC. trpp-6 sgRNA #1: AAAAGATCGATGTGAAGCAA; trpp-6 sgRNA #2: GCTCCGCGAAGTAAACCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3349 |
C. elegans |
R03H10.7(ve849[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1234 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAGATGTATAATACAATGGTGTTGAAG ; Right flanking sequence: TAAATCGAGATTTTAATGAAATTATTACAT. R03H10.7 sgRNA #1: TTATGTTGGAATTTGACTGA; R03H10.7 sgRNA #2: CAGTTCTGCTATGTGCTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3350 |
C. elegans |
arc-1(ve850[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2121 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAGCAAATGTTTCAGTTAATGAATGAATA ; Right flanking sequence: GCCCTGTATAGTTTTCTGTCGGAATTTATA. arc-1 sgRNA #1: TGGTTGCAACGTGTGCAACG; arc-1 sgRNA #2: ATGTACCATTAAGACGACTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3351 |
C. elegans |
ttc-17(ve851[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 4149 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCGCGTGGAATACGACTGCAATCCGACAG ; Right flanking sequence: GGAAAGAATTCGAGTTTTAATTGTTGAATT. ttc-17 sgRNA #1: TTTCCACACGTCTTTCACCG; ttc-17 sgRNA #1: CAGCATGGCAATATATCGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3352 |
C. elegans |
asp-5(ve852[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1561 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCACGACCATTTTTCCAGGTATGAAGACCA ; Right flanking sequence: GGGATTCGCCAACTCCCTTCAGGCCAATTA. asp-5 sgRNA #1: GGCAACTAGTGCTACGAAAG; asp-5 sgRNA #2: GATATTGGAGGACAACGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3353 |
C. elegans |
F41E6.5(ve853[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:ATTCAAACTCTCTACTGTAAAATGACTCCG ; Right flanking sequence: GGGACTTGCCACATCGGTATTTTCTTTCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3354 |
C. elegans |
veDf3 [LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] V. Show Description
Homozygous viable. Deletion of 4002 bp removes his-8, his-7, his-6, his-5, and his-39, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGTGATTTGCTTTCAGCAATTGAATGC ; Right flanking sequence: GCATTCAATTGCTGAAAGCAAATCACCGAA. his-8/his-39 sgRNA #1: ATTGAATGCTTACTTGCTAG; his-8/his-39 sgRNA #1: ATTGAATGCTTACTTGCTAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|