Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
RG3322 C. elegans got-2.1(ve822[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2683 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCAACTCTGGATTACTCAAAATCCGTGAA ; Right flanking sequence: CGGGAGCACTGGTTGAGCAGTTACAGTAGT. sgRNA #1: GCAATTCTTGCTCCATGAAG; sgRNA #2: AGCGGCACATTTCTGAACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3359 C. elegans got-2.2(ve859[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1476 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAGCGTTTCCAAGAAGCTTTTCTCTACCG ; Right flanking sequence: AAGTAAATCAGTGACAAATGCACTCTTCCC. got-2.2 sgRNA #1: CCGTGCGAGGAAAGTCGTGG; got-2.2 sgRNA #2: GGTGACTTGGTGGAGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.