Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RG3341 C. elegans phf-5(ve841[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 2354 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve841 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  Left flanking Sequence: TGTGTGATTTGTGATTCACATGTTCGTCCA; Right flanking sequence: AGGATCGTGACGGATGCCCGAAAATTGTGA. phf-5 sgRNA #3: CAGATACGAACCAATGTACA; phf-5 sgRNA #4: AGAATGCACAATTCTCGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.