Strain Information

Name RG3335   View On Wormbase
Species C. elegans
Genotypenep-6(ve835[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
DescriptionHomozygous viable. Deletion of 3709 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTCTGCGAAAGATAAGCTGGCCAATCCT ; Right flanking sequence: ATATGCCACAATTTGCGACAGCATTCAACT. nep-6 sgRNA #1: AACACGACTAGAGCAATCAG; nep-6 sgRNA #2: TGGAAAAGATCCCATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
MutagenCrispr/Cas9
Made byRG KO Group
Laboratory RG
Reference n/a
Sign in or register an account if you want to order this strain.