Strain Information
| Name | ME564 View On Wormbase |
|---|---|
| Species | C. briggsae |
| Genotype | Cbr-lin-4(ae79) aeIs15 II; Cbr-mir-241 Cbr-mir-48(ae73) V; Cbr-hbl-1(aeIs12[Cbr-hbl-1::AID]) Cbr-mir-84(ae70) X. |
| Description | aeIs15 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. AID tag inserted at C-termini of endogenous hbl-1 locus. Vulvaless with heterochronic defects (increased number of seam cells and incomplete adult alae). Heterochronic phenotypes are suppressed in the presence of 5-Ph-IAA. ae79 deletion removes structural parts and an essential seed sequence of Cbr-lin-4. Putative null alleles of let-7 family miRNAs Cbr-mir-241, Cbr-mir-48, and Cbr-mir-84. ae73: AAATGCACGTATAGGATGGGCTTCT<12,897 bp del>CGGGTTGGGACACAAACAACTCTTT. ae70: TTTTGAACAGCCGAGGAA-------TGATGTTGACTTTTCAGTTACGTC. ae79: GCC------CTGAGACCTCAAGTGTGAGCGTTCTGAACAT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Maria Ivanova |
| Laboratory | ME |
| Reference | 10.1093/genetics/iyad177 (publication in progress) |
Sign in
or
register an account if you want to order this strain.