Strain Information
| Name | ME487 View On Wormbase |
|---|---|
| Species | C. briggsae |
| Genotype | Cbr-let-7(ae48) X. |
| Description | Egg-laying defects, sometimes burst at vulva. Extra molts. ae48 deletion that removes structural parts and an essential seed sequence of let-7 miRNA (null allele). WT:ATTTTTCAGGGGATTGCAGGATGATGGCTCTACACTGGGGTACGGTGAGGTAGTAGGTTG TATAGTTTAG; ae48: ATTTTTCAGGG |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x1 |
| Made by | Maria Ivanova |
| Laboratory | ME |
| Reference | 10.1093/genetics/iyad177 (publication in progress) |
Sign in
or
register an account if you want to order this strain.