Search Strains

mir-61 (F55A11.9), mir-250 (F55A11.12) and part of F55A11.3 are deleted in nDf59. Deletion breakpoints are:TGGATTTCCACAACAACCAGCTGGTGCC / GGAGGTGCTCAGCCTGG...GTTCTAGTCATTGCC / ATACGGAGGAAGGACTAAGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

C32D5.5 deletion allele.

Temperature-sensitive Egl. Reference: Genetics (1983) 104:619-47.

Weak suppressor of egl-6(n592). 945 bp deletion. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008, 11(10):1168-76.

Temperature-sensitive Egl. Reference: Genetics (1983) 104:619-47.

Double mutant is Muv. lin-35 alone is non-Muv. lin-35 is a class B synthetic Muv.

Deletion breakpoints are:CTACAAAAACTATTCCATTC / AAAAAACGGCTGTCAGTGC...AGAGACGATTTGTGTCGA / TTTACGAAATTTTCCTCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Double mutant is Muv. n758 alone is not Muv.

Reference: Andersen EC & Horvitz HR., Development. 2007 Aug;134(16):2991-9.

Reference: Andersen EC & Horvitz HR., Development. 2007 Aug;134(16):2991-9.

Suppressor of unc-93(e1500). Weak maternal effect sterile and dumpy. Reference: Ma L, Horvitz HR. PLoS Genet. 2009 Nov;5(11):e1000708.

DpyUnc. Semidominant Unc.

Deletion of C43E11.3 splice donor for the 4th exon through exon 7.

Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.

Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

Long. Muv.

Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.

nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62.

Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.

nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Bli; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.

nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.

Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ and segregate WT green-glowing heterozygotes and non-glowing rba-1 homozygotes. rba-1(n5418) homozygotes are sterile or produce eggs that fail to hatch. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Nakano S, Stillman B, Horvitz HR. Cell. 2011 December 23; 147(7): 1525-1536.

nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. nIs454 [mab-10p::mab-10::GFP + ttx-3p::GFP] II. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62.

Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.

Heterozygotes are Vul and segregate Vul, UncVul and dead eggs. Maintain by picking Vul non-Unc.

Rubberband Unc. Muv.

Heterozygotes are WT and segregate WT, UncVul and dead eggs. The UncVuls are small, kinky, paralyzed and vulvaless. Maintain by picking WT.

Heterozygotes are WT and segregate WT, UncVul and dead eggs. UncVuls are small, kinky, paralyzed and vulvaless. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs, and VulUnc. VulUncs are small, kinky, paralyzed and vulvaless. Maintain by picking WT.

kyIs511 [gcy-36p::GCaMP + unc-122p::GFP]. nEx2316 [gcy-36p::gur-3 + ges-1p::GFP]. Pick animals with GFP expression in gut to maintain. Expression of gcy-36p::gur-3 causes URX to respond to light 30% of the time. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. doi: 10.1016/j.neuron.2014.12.061. PMID: 25640076.

Heterozygotes are WT (slightly Unc) and segregate WT, Unc-36 and dead eggs. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1171 homozygotes) and dead eggs.

Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1172 homozygotes) and dead eggs.

Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygtes), arrested larvae (n493n1173 homozygotes) and dead eggs.

WT revertant.

Non-Unc.

Dominant Egl. Unc. Dpy (ts). Throws males.

Small. Unc. Muv.

SmaUnc. Not Muv.

Heterozygotes are Sma. At 25C, hets segregate Sma, SmaMuv (lin-8; sma-3 lin-37), and SmaUncMuvSte (lin-8; sma-3 lin-13 unc-36). At 15C, hets segregate Sma, SmaMuv (lin-8; sma-3 lin-37) and SmaUnc which give sterile F2 (lin-8; sma-3 lin-13 unc-36). n387 is a ts maternal effect mutation.

5% XO self-progeny.

Egl. Maintain under normal conditions. Reference: DeVore DL, et al. Cell. 1995 Nov 17;83(4):611-20.

Egl. Maintain under normal conditions. Reference: DeVore DL, et al. Cell. 1995 Nov 17;83(4):611-20.

n997: Egl, 5HT-S, IMIP-R.

Vul. Unc-Very sluggish as L1, moves better as adult. Weak kinker. Head region stiff. Moves better in reverse, fairly active.