| NK2694 |
C. elegans |
bmdSi15 rpl-31(qy110[rpl-31::gfp11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.
|
|
| NK2730 |
C. elegans |
rpl-4(qy128[rpl-4::gfp11]) bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-41 locus.
|
|
| NK2789 |
C. elegans |
bmdSi15 I; shy61(sec-61.B::GFP11x2) IV. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). 2x split GFP tag (GFP11) inserted into the C-terminus of the endogenous sec-61.B locus.
|
|
| NK2811 |
C. elegans |
F25H2.6(qy162[F25H2.6::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous F25H2.6 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2902 |
C. elegans |
bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. Show Description
qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3' UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3' UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. L4-specific expression of ZIF-1, ubiquitous GFPbeta1-10 and endogenous rpl-31 tagged with ZF-1+GFP-beta11
|
|
| NK3211 |
C. elegans |
nuo-1(qy145[nuo-1::mNG]) II; emb-9(qy244[emb-9::mRuby2]) III; unc-6(ev400) X. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus. Unc-6 netrin mutation causes reduced movement and protruding vulva (Pvl) phenotype.
|
|
| NK364 |
C. elegans |
unc-119(ed3) III; qyIs46. Show Description
qyIs46 [emb-9p::emb-9::mCherry + unc-119(+)] X. Superficially wild-type with very low penetrance (~5%) rupture. Integrated collagen::mCherry reporter. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
|
|
| NK651 |
C. elegans |
unc-119(ed4) III; qyIs108. Show Description
qyIs108 [lam-1p::lam-1::Dendra + unc-119(+)]. High expression in basement membranes; cleaner laminin-dendra expression than NK652. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
|
|
| NK652 |
C. elegans |
unc-119(ed4) III; qyIs109. Show Description
qyIs109 [lam-1p::lam-1::Dendra + unc-119(+)]. High expression in basement membranes, also accumulates in body wall muscle. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
|
|
| NK696 |
C. elegans |
unc-119(ed4) III; qyIs127. Show Description
qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
|
|
| NK774 |
C. elegans |
unc-119(ed4) III; qyEx116. Show Description
qyEx116 [C14A11.3b::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| NK775 |
C. elegans |
unc-119(ed4) III; qyEx117. Show Description
qyEx117 [C14A11.3a,c::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| NK860 |
C. elegans |
unc-119(ed4) III; qyIs161. Show Description
qyIs161 [emb-9p::emb-9::Dendra + unc-119(+)]. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
|
|
| NK885 |
C. elegans |
unc-119(ed4) III; qyIs174. Show Description
qyIs174 [hlh-2p::GFP::hlh-2 + unc-119(+)]. Translational fusion protein displaying cytoplasmic and nuclear localization; contains 8 kb upstream, N-terminal GFP fusion, full open reading frame and 3'UTR. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.
|
|
| NK887 |
C. elegans |
unc-119(ed4) III; qyIs176. Show Description
qyIs176 [zmp-1(50-51)p::mCherry::moeABD + unc-119(+)]. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.
|
|
| NL1590 |
C. elegans |
dpy-20(e1282) IV; pkIs539. Show Description
pkIs539 [gpa-11(XS)(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1608 |
C. elegans |
dpy-20(e1282) IV; pkIs588. Show Description
pkIs588 [gpa-11::GFP + dpy-20(+)]. Reporter construct includes 3030 bp upstream of ATG to +98 in exon 1 fused in frame with GFP in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
| NL1611 |
C. elegans |
dpy-20(e1282) IV; pkIs591. Show Description
pkIs591[dpy-20(+) + gap-15::GFP]. GFP expression in ADL, ASH, ASK, PHA, PHB, distal tip cell, anchor cell, and many male-specific neurons.
|
|
| NL1787 |
C. elegans |
unc-13(e51) I. NL subclone of KR1787. Show Description
NL subclone of KR1787. NL received strain KR1787 from Ann Rose 11/93. High copy Tc1 strain. See WBG 14(4): 16-17.
|
|
| NL2035 |
C. elegans |
rsd-6(pk2011) I. Show Description
Tc1 insertion in F16D3.2. Resistant to feeding dsRNA. Sensitive to gonadal injection of dsRNA.
|
|
| NL2037 |
C. elegans |
rsd-3(pk2013) X. Show Description
Tc1 insertion in C34E11.1. Resistant to feeding dsRNA. Sensitive to gonadal injection of dsRNA.
|
|
| NL2099 |
C. elegans |
rrf-3(pk1426) II. Show Description
Homozygous rrf-3 deletion allele. Increased sensitivity to RNAi when compared to WT animals. Deletion sequence (deletion in lower case letters, flanking undeleted sequence in capital letters): TGCACATATTctacagaatt ------- --------tacccgattaAATGGACAATT (from Plasterk Lab 11/05).
|
|
| NL2511 |
C. elegans |
msh-6(pk2504) I. Show Description
Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6).
|
|
| NL3511 |
C. elegans |
ppw-1(pk1425) I. Show Description
ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557.
|
|
| NL587 |
C. elegans |
acy-1(pk311) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
|
|
| NL711 |
C. elegans |
mut-2(r459) I; feb-1(pk61). Show Description
|
|
| NL787 |
C. elegans |
gpa-11(pk349) II. Show Description
|
|
| NM1081 |
C. elegans |
snb-1(js124)/dpy-11(e224) unc-68(r1158) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and L1 lethals. js124 homozygotes arrest as L1 larvae that are very uncoordinated and tend to adopt a coiled position. js124 molecular lesion is an amber mutation at codon 50.
|
|
| NM1489 |
C. elegans |
dhc-1(js319) I; jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.May be slightly Unc. dch-1 alias sam-11.
|
|
| NM1581 |
C. elegans |
rpy-1(ok145) II. Show Description
Viable, fertile, with no obvious behavioral or morphological phenotypes. A 1677 bp deletion in the C18H9.7 gene which encodes a C. elegans homolog of the rapysn (vertebrate) gene. The lesion deletes exons 4 through 10, leaving exons 3 and 11 in frame. The deletion junction is cagaagaaaaagttcgctttgaactaaAGAACCTATTGAAAATTCTTACTT. Previously called rap-1.
|
|
| NM211 |
C. elegans |
rab-3(y251) II. Show Description
Ric; very slightly slow and loopy movement. Aberrant EPG.
|
|
| NM4244 |
C. elegans |
jsIs973 III; jsIs609 X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. jsIs609 [mec7p::mtGFP + lin-15(+)] X. Strong RFP cytosolic marker for the mechanosensory neurons (Zheng et al. 2011, PMID 21115607). GFP mitochondrial marker expressed in mechanosensory neurons (Mondal et al. 2012, PMID 23051668).
|
|
| NM4337 |
C. elegans |
rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. Show Description
rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.
|
|
| NM4397 |
C. elegans |
jsIs973 III; ptrn-1(js1286) X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607).
|
|
| NM4422 |
C. elegans |
jsIs973 III; oxIs12 ptrn-1(tm5597) X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. oxIs12 [unc-47p::GFP + lin-15(+)] X. oxIs12 integration maps at +2.0 on X. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607). Expression of GFP in all GABAergic neurons.
|
|
| NM4431 |
C. elegans |
rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. Show Description
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.
|
|
| NM5161 |
C. elegans |
jsTi1453 I; bqSi711 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. jsTi1453 is an RMCE landing site inserted using miniMos on Chr I at 11,933,068 ( at 13.1 m.u.) between R06C1.4 and R06C1.6. Insertion site ccctactatcaacgcaaaaactatttggcttttactTAaacataacgttttgaatttgaaaatcaaaaag with rpl-28p trancription toward R06C1.4. bqSi711 expresses nNeonGreen in germline and early embryo. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5179 |
C. elegans |
jsTi1493 IV. Show Description
jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsTi1493 is an RMCE landing site inserted using miniMos located on Chr IV at 9,197,338 (at 4.11 m.u.) inserted between C46C2.7 and wnk-1. Insertion site gttcgcaaaccgtctgcgtctctTAttctcttgcaattccgcgcacacac with rpl-28 transcription toward C46C2.7. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5187 |
C. elegans |
jsTi1453 I; him-8(e1489) IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsTi1453 is an RMCE landing site inserted using miniMos located on Chr I at 11,933,068 (at 13.1 m.u.) between R06C1.4 and R06C1.6. Insertion site ccctactatcaacgcaaaaactatttggcttttactTAaacataacgttttgaatttgaaaatcaaaaag with rpl-28p trancription toward R06C1.4. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5322 |
C. elegans |
jsSi1570 I; bqSi711 IV. Show Description
jsSi1570 [delta_mosL::loxP::rpl-28::FRT::GFP::his-58::FRT3::mosR] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chromosome I. Derivative of jsTi1453 lacking the left mos1 arm.
|
|
| NM5402 |
C. elegans |
jsSi1579 II; bqSi711 IV. Show Description
jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
|
|
| NW1229 |
C. elegans |
dpy-20(e1362) IV; evIs111. Show Description
evIs111 [F25B3.3::GFP + dpy-20(+)]. Pan-neural expression.
|
|
| NW1615 |
C. elegans |
plx-1(ev724) jcIs1 IV; him-5(e1490) V. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.
|
|
| NW1619 |
C. elegans |
dpy-11(e224) mig-6(ev700) V/eT1 (III;V). Show Description
Heterozygotes display abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, Dpy, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
|
|
| NW1623 |
C. elegans |
dpy-11(e224) mig-6(ev788) V/eT1 (III;V). Show Description
Heterozygotes display partially penetrant (~10%) abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
|
|
| NW1625 |
C. elegans |
dpy-11(e224) mig-6(e1931) V/eT1 (III;V). Show Description
Heterozygotes are wild-type and segregate WT, Dpy-Ste Unc, and dead eggs. Maintain by picking wild-type.
|
|
| NW1692 |
C. elegans |
him-5 V; evIs190. Show Description
evIs190 [vab-1p::Venus + rol-6(su1006)]. Rollers. Reference: Ikegami et al. Curr Biol. 2012 Jan 10;22(1):1-11.
|
|
| NW1702 |
C. elegans |
smp-1(ev715) I; jcIs1 IV; him-5(e1490) V. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Strain does not Roll but otherwise seems fine. Male ray 1 anterior displacement in homozygous animals. Genetic interaction with smp-2(ev709). Vulva cell migration defects. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.
|
|
| NW1704 |
C. elegans |
smp-2(ev709) I; jcIs1 IV; him-5(e1490) V. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Strain does not Roll but otherwise seems fine. Male ray 1 anterior displacement in homozygous animals. Genetic interaction with smp-1(ev715). ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.
|
|
| NW411 |
C. elegans |
enu-1(ev419) II; vab-8(ev411) V. Show Description
ev411 was previously called unc-107.
|
|