Search Strains

vxEx540 [tax-4(fosmid) + unc-122p::GFP]. Pick animals with GFP expression in coelomocytes to maintain array. This strain rescues tax-4 function with fosmid WRM069cE04 that includes full tax-4 genomic DNA. Reference: Russell J, et al. Proc Natl Acad Sci U S A. 2014 Jun 3;111(22):8269-74.

vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD, FLP, and BDU via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx582 [gcy-8p::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxIs601 [egl-1p::mCherry::egl-1 3'UTR + unc-122p::GFP]. Transcriptional reporter for apoptotic trigger egl-1. mCherry expression in URX adult neurons and apoptotic cells. Reference: Cohn J, et al. G3 (Bethesda). 2019 Nov 5;9(11):3703-3714. doi: 10.1534/g3.119.400654. PMID: 31519744.

vxEx611 [mtq-2p::mCherry::unc-54 UTR + unc-122p::GFP]. Pick mCherry+/GFP+ to maintain. mCherry is expressed in ventral cord neurons and most head neurons. Reference: Nordquist, S.K., Smith, S.R., and Pierce, J.T. (2018) G3: Genes|Genomes|Genetics, g3.200019.2018. http://doi.org/10.1534/g3.118.200019.

Heterozygotes are WT and segregate WT, RolUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf2 formerly called zen-1(w1). sc8 previously called rol-4(sc8).

Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf1 formerly called zen-1(e2482). 2/02: dpy-21 appears to have been lost from this strain.

Halicephalobus mephisto wild isolate. Grow at 37C: can survive higher temperatures than C. elegans. Useful model organism for studying heat tolerance; has expanded Hsp70 and AIG1 gene families. Has approximately 1.15% snp heterozygosity. Parthenogenetic reproduction so it cannot be out-crossed. References: Borgonie G, et al. Nature. 2011 Jun 2;474(7349):79-82. Weinstein DJ, et al. Nat Commun. 2019 Nov 21;10(1):5268.

Heterozygotes are WT and segregate WT, Dpy Stu, Unc-36 (eT1 homozygotes) and dead eggs. Also weak Him.

Long defecation cycle period. Slightly slow growing and scrawny.

Hid.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Endogenous hsf-1 tagged with the auxin-inducible-degron (AID*) and GFP allows depletion of endogenous HSF-1 in the somatic tissues upon auxin treatment. Animals treated with 1mM of auxin when eggs are laid will arrest in L1 or L2 stage. Reference: Edwards SL, et al. Cell Rep. 2021 Aug 31;36(9):109623. PMID2021 Aug 31;36(9):109623. PMID: 34469721

Male-female strain. Isolated by Marie-Anne Felix from decomposing fruit and vegetables sampled on March 11, 2007, in small vegetable gardens in Okazaki (East of Nagoya), Aichi Prefecture, Japan. Isofemale line. Maintain by mating.

Caenorhabditis sp. 11 Isolated by Marie-Anne Felix from rotting torch ginger (Etlingeria elatior) flowers sampled in the island of La Réunion by Valérie Robert and Loïc Sablé in Jan 2008. Hermaphrodite. Culture at 20°C or above. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis sp. 12 Male-female strain. Isolated in Nouragues, French Guiana. Reference: Kiontke KC, et al. BMC Evol Biol. 2011 Nov 21;11:339.

Caenorhabditis sp. 11 Isolated by Marie-Anne Felix from rotting Duguetia surinamensis fruit, sampled by Patrick Châtelet on the "Petit Plateau" in the Nouragues Forest, French Guyana in May 2008. Hermaphrodite. Culture at 20°C or above. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated from rotting palm fruit sampled by MAF on 9 June 2008 in the Park Guëll, Barcelona, Spain. Picked as young adult on 11 June 2008. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis sp. 18 Male-female strain. Isolated in Nouragues, French Guiana. Reference: Kiontke KC, et al. BMC Evol Biol. 2011 Nov 21;11:339.

Isolated in Sanda Center, Indonesia . Reference: Kiontke KC, et al. BMC Evol Biol. 2011 Nov 21;11:339.

Caenorhabditis sp. 14 Male-female strain. Isolated in Petit-Bourg, Guadeloupe. Reference: Kiontke KC, et al. BMC Evol Biol. 2011 Nov 21;11:339.

Isolated by Marie-Anne Felix. Merlet, Lagorce (Ardeche), France, on September 8, 2002, in wash from snail tube - snails coming from under a tree full of ivy. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

oxSi120 [peel-1p::tagRFP::MSP-142 3'utr+ unc-119(+)]. Him. Derived from EG5897 and CB1489; not known if is unc-119(ed3) is still present in background. Reference: Batchelder EL, et al. Proc Natl Acad Sci U S A. 2011 Jul 12;108(28):11429-34.

Synthetic Roller after L4 stage (85% penetrance). je5 is dominant and je11 is recessive. See 1996 East Coast Worm Meeting Abstract #80.

louIs7 [ges-1p::sqst-1::mCherry::GFP::unc-54 3'UTR]. Tandemly-tagged p62/sequestosome marker expressed in the gut can be used to monitor autophagic activity. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

MT15501 mir-83(n4638) was outcrossed 6x to produce this strain. Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Combination mutant made with 6x outcrossed lines KB10 mir-67(n4899) and KB11 mir-83(n4638).

otIs672 [rab-3p::NLS:: GCaMP6s + arrd-4p::NLS::GCaMP6s]. See description of strain OH16230 for full description of otIs696 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. 2-nonanone avoidance and electrical shock response of KDK94 are more similar to wild-type (N2) than other NeuroPAL strains. Derived by crossing parental strains OH15265 and OH15495. References: Endo Y, et al. J Biosci. 2025:50:52. PMID: 40619772. NeuroPAL reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642.

Heterozygotes are WT and segregate WT, DpyUnc, and UncRol (which give only dead eggs). Maintain by picking WT. mel-11 is not strict. See also WBPaper00002726.

huIs120 [hsp-16.2p::sfrp-1 + myo-2p::Tomato]. Wild-type under normal culture conditions. Heat-shock (10 min) during embryogenesis causes embryonic lethality and HSN migration defects. Heat-shock (10 min) at hatching causes Ql and QR migration defects. Reference: Harterink M, et al. Development. 2011 Jul;138(14):2915-24.

tm1095 enhances Q neuroblast migration and vulva induction phenotype of pry-1. Minor defect in excretory cell development. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.

nuIs26 [cat-1::GFP] IV. nuIs26 contains a full length CAT-1::GFP fusion protein (with GFP fused at the predicted carboxy terminus of CAT-1). This transgene rescues the hyperactive locomotion defect of cat-1(e1111). This strain is slightly sluggish for locomotion and has a high degree of sterility (80%), both of which appear to be associated with the transgene. GFP expression in this strain is similar to the CAT expression pattern described by Duerr et al (1999) J Neurosci 19: 72-84.

nuIs190 [unc-129p::ins-22::Venus + myo-2p::NLS::GFP] X. Pick GFP+ to maintain. Not all animals express GFP. Array might be prone to silencing or not homozygous. [NOTE: nuIs190 was previously described as carrying myo-2p::GFP without an NLS.] Reference: Ch'ng Q, Sieburth D, Kaplan JM. PLoS Genet. 2008 Nov;4(11):e1000283.

nuIs214 [unc-129p::itsn-1::GFP + myo-2p::GFP] III.

Reference: Hu Z, et al. Neuron. 2011 Jul 14;71(1):92-102.

Pick wild-type to maintain. Segregates wild-type, Dpy Unc, arrested hT1 homozygotes, and dead eggs. Reference: McKim KS, et al. Genetics. 1988 Dec;120(4):987-1001.

Dpy. Segregatess DpyUncs. Slow. DpyUnc will take over. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dpy-5 phenotype. Segregates Dpy-5 and Unc-11 Dpy-5 progeny. Duplication-bearing animals are slow-growing, and UncDpys will overgrow the population. Pick several Dpy-5 animals and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dpy-5 phenotype. Segregates Dpy-5, Unc-11 Dpy-5. Duplication-bearing animals are slow-growing, and UncDpys will take over population. Pick several Dpy-5 animals and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dpy-5 phenotype. Segregates Dpy-5, Unc-11 Dpy-5. Duplication-bearing animals are slow-growing, and UncDpys will take over population. Pick several Dpy-5 animals and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Unc phenotype. Slow. DpyUnc will take over. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Unc phenotype. Slow. DpyUnc will take over. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in mid larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are Dpy Unc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are Dpy Unc and arrest in early-mid larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in late larval development.