Search Strains

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-4 non-GFP, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.

umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

umnIs35 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

umnIs36 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Homozygous-viable translocation marked with bli-4 and mKate2. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Hets are WT mKate2+ and segregate WT mKate2+, Unc-4 (no red fluorescence) and paralysed DpyUnc mKate2+ (mnC1). Maintain by picking WT mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain SP127 using CRISPR/Cas9.

umnIs38 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Homozygous-viable translocation marked with bli-4 and GFP. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.

umnIs39 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs40 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs, and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by simultaneous insertion of independent myo-2p::mKate2 and myo-2p::GFP transgenes into each portion of the szT1 balancer in parental strain AF1 using CRISPR/Cas9.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Dpy mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain BC4279 using CRISPR/Cas9.

umnIs42 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate2+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2, Unc-4 non-mKate2, and Dpy mKate2+ mIn1 homozygotes. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.

umnIs44 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs45 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.

umnIs47 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs48 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.

umnIs50 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type mKate2+; animals that have lost the Dup are Dpy Unc mKate2-. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.

umnIs51 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

umnIs53 [myo-2p::GFP + NeoR, V:18120303 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs54 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-mGFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

umnIs55 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, Unc-36 mKate+(eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs56 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.

umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.

Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.

umnIs59 [myo-2p::mKate2 + NeoR, I:6284001(intergenic)] I. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs60 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous-viable translocation marked with bli-4 and mKate2. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.

Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

umnIs62 [myo-2p::mKate2 + NeoR, III:8856215 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs63 [myo-2p::GFP + NeoR, II:11755713 (intergenic)] II. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs64 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. tmIn8 is a CRISPR/Cas9-induced inversion between F13D12.6 and cup-14 in LG II covering region (Mb) 2.1 (11.7..13.9). Derived by insertion of myo-2p::GFP transgene into parental strain FX19134 using CRISPR/Cas9.

umnIs65 [myo-2p::mKate2 + NeoR, V:4308261 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs66 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs69 [myo-2p::GFP + NeoR, V:4308261(intergenic)] V. Break points: In(srbc-66 T10H9.8) V. Covered region (Mb) 3.1 (3.5..6.7). Derived by insertion of myo-2p::GFP transgene into parental strain FX19702 using CRISPR/Cas9.

umnIs70 [myo-2p::GFP + NeoR, X:6745526(intergenic)] X. tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. Derived by insertion of myo-2p::GFP transgene into parental strain FX19171 using CRISPR/Cas9.

umnIs68 [myo-2p::GFP + NeoR, I:6284001(intergenic)] I. Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3). Derived by insertion of myo-2p::GFP transgene into parental strain FX19704 using CRISPR/Cas9.

umnIs72 [myo-2p::GFP + NeoR, I:6284001 (intergenic)] I. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs74 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] X. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::GFP transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.

umnIs76 [myo-2p::GFP + NeoR, V:4308261 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs77 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.