Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
CGC72 C. elegans npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CHS1121 C. elegans npr-19(yum1708) X; npr-23(yum1709) I; h23l24.4(yum1711) t02d1.4(yum1712) IV; zk813.5(yum1710) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS8177 C. elegans npr-23(sy1203) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-23. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGCTTCACCAACTTGATCGCGTTGCTCGTATTGG; right flanking sequence: TGCCGGTGATCATTCATAACGTGTTCACCGGTGTC. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGCGTTGCTCGTATTGGTGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616