Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strain XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.

qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.

ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.

Y106G6A.2. Homozygous. Outer Left Sequence: TTCGGCTGACATGAAGACTG. Outer Right Sequence: CTTCAACAGCAAATGCCTGA. Inner Left Sequence: CGAAGGGTATGGGGAGAAAT. Inner Right Sequence: GGGGAACGAAACCCATAAGT. Inner Primer PCR Length: 2400 bp. Deletion Size: 1281 bp. Deletion left flank: GTGCGCCTTTAGAGTACTTTAGTTTCAAAC. Deletion right flank: AACCGGGTTATTGTCGATTCAATATTCATG. [NOTE (11-18-2015) A user has reported that this strain was heterozygous for ok2561 by PCR analysis.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15F1.3 Homozygous. Outer Left Sequence: aaccagaaaagtcgccttga. Outer Right Sequence: tccacatcaagcatccagaa. Inner Left Sequence: ttggtgtgatggcaaagatg. Inner Right Sequence: atgcattcctgcgattcttc. Inner Primer PCR Length: 3370. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38A6.3 Homozygous. Outer Left Sequence: aatcttgacgtcctctggga. Outer Right Sequence: acggaggtatgaggacaacg. Inner Left Sequence: tggaagacaatcggaaaagg. Inner Right Sequence: taaatcggagccagatccac. Inner Primer PCR Length: 2977. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15C7.2 Homozygous. Outer Left Sequence: ttaaaaatgctgagggtggc. Outer Right Sequence: caatgggcaaagacgagaat. Inner Left Sequence: tggcaaatatcattgcagga. Inner Right Sequence: cggtgacgagagagtcacaa. Inner Primer PCR Length: 2903. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0207.10 Homozygous. Outer Left Sequence: agtgatatgtgatgtggccg. Outer Right Sequence: accgtaaccccctttttcac. Inner Left Sequence: ttggcgagaacgttcaataa. Inner Right Sequence: tgtgttctctgtccccacaa. Inner Primer PCR Length: 1200. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07B1.2 Homozygous. Outer Left Sequence: accctaaacgacattcgcac. Outer Right Sequence: aactatgcatgtgcatccca. Inner Left Sequence: aaacatctcaaaaatgcccg. Inner Right Sequence: gctcacgctaccatttcctc. Inner Primer PCR Length: 2100. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H14N18.4. External left primer: TTCCGAGTCTGGCTGAAACT. External right primer: GGCGGATTTGTCATGACTCT. Internal left primer: AAATTGTCGCGTTGCTTACC. Internal right primer: TGCGTAAGATATTTTCTCATAACTG. Internal WT amplicon: 1211 bp. Deletion size: 844 bp. Deletion left flank: TTAGAAAATTATTTTGAAAAGTGTTAAATT. Deletion right flank: GTTTCACGAGCATTTATAGTTTGACACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807